Incidental Mutation 'R8171:Ly75'
ID 634083
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8171 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60292103-60383303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 60314228 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1297 (T1297I)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect possibly damaging
Transcript: ENSMUST00000028362
AA Change: T1297I

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: T1297I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112533
AA Change: T1297I

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: T1297I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,025 A661E probably benign Het
4932438A13Rik T C 3: 36,975,713 V2423A probably benign Het
4933425L06Rik T A 13: 105,109,783 V284E probably benign Het
Abhd14a T A 9: 106,440,761 T142S probably benign Het
Actn1 A G 12: 80,196,393 probably null Het
Adss T C 1: 177,796,351 N15S probably benign Het
Alpk2 A G 18: 65,305,983 S780P probably benign Het
Asap1 G T 15: 64,110,966 L830M probably damaging Het
Atic T C 1: 71,569,873 V319A possibly damaging Het
Atp8a2 A T 14: 60,046,044 I87N probably damaging Het
Bace2 G T 16: 97,424,586 V407L possibly damaging Het
Bmp3 A T 5: 98,872,669 Y317F probably damaging Het
Ccdc159 A G 9: 21,933,711 E291G possibly damaging Het
Cct8l1 T A 5: 25,516,554 L89Q probably damaging Het
Cep83 T A 10: 94,768,935 N503K possibly damaging Het
Ces4a A G 8: 105,147,207 Y436C probably damaging Het
Cftr T A 6: 18,258,288 D579E probably damaging Het
Chd9 T A 8: 91,025,387 V1751D possibly damaging Het
Clasp2 A T 9: 113,903,906 T937S possibly damaging Het
Clock T A 5: 76,266,414 D17V possibly damaging Het
Cpm T C 10: 117,683,315 L376P probably damaging Het
Crocc2 T C 1: 93,189,001 probably null Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Cyb5r4 C T 9: 87,042,810 L206F possibly damaging Het
Cyp1a1 T A 9: 57,700,196 W36R probably benign Het
Cyp3a59 A T 5: 146,085,774 H30L probably damaging Het
Dab2 G A 15: 6,423,926 V182I probably benign Het
Dnah1 G T 14: 31,297,110 F1342L probably damaging Het
Draxin A T 4: 148,115,666 L109Q possibly damaging Het
Elfn1 G A 5: 139,971,357 V39M probably damaging Het
Erlin1 A G 19: 44,069,329 I19T probably benign Het
F830016B08Rik T A 18: 60,300,078 S78T possibly damaging Het
Fer1l4 A G 2: 156,048,231 V258A probably benign Het
Fgb T C 3: 83,042,515 D445G probably damaging Het
Fgd6 T C 10: 94,074,332 probably null Het
Frem3 T A 8: 80,615,240 D1387E probably damaging Het
Gdf3 T C 6: 122,609,903 T22A probably benign Het
Glcci1 C T 6: 8,593,167 A511V probably benign Het
Gldc A T 19: 30,133,761 N538K probably benign Het
Glipr1l1 C T 10: 112,078,384 P217S probably benign Het
Gm15800 A G 5: 121,318,756 E728G possibly damaging Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr161 A G 1: 165,306,436 N89S probably damaging Het
Gypa T A 8: 80,509,463 S166T probably benign Het
Hcar1 A G 5: 123,879,089 S180P probably damaging Het
Hcn1 T C 13: 117,602,734 S11P unknown Het
Itih1 A T 14: 30,937,090 M323K possibly damaging Het
Ivl A G 3: 92,571,778 S327P probably damaging Het
Kcnt2 T A 1: 140,509,465 N545K probably benign Het
Kdm4b A T 17: 56,389,534 R417W probably damaging Het
Kif13a T C 13: 46,778,968 E1083G probably damaging Het
Klhl40 A T 9: 121,778,557 H261L probably benign Het
Kpnb1 A G 11: 97,175,747 probably null Het
Lamc3 C A 2: 31,914,971 T621N probably benign Het
Lingo3 T C 10: 80,834,761 H445R probably benign Het
Lypd6 C T 2: 50,190,747 T149M possibly damaging Het
Mcrs1 A T 15: 99,248,732 D139E probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Mybpc1 C T 10: 88,523,003 G1095R probably damaging Het
Myh1 A G 11: 67,202,572 Y163C probably damaging Het
Notch4 T A 17: 34,582,509 C1110* probably null Het
Olfr1257 A G 2: 89,881,065 I80V probably benign Het
Olfr527 A T 7: 140,336,230 I123F probably damaging Het
Olfr705 C T 7: 106,714,618 S21N probably benign Het
Olfr705 T A 7: 106,714,619 S21C Het
Pcsk1 T A 13: 75,090,091 C10* probably null Het
Pdlim5 A T 3: 142,312,187 S107T probably benign Het
Plac8l1 T A 18: 42,180,380 D99V probably damaging Het
Plin2 A T 4: 86,657,112 V400E probably damaging Het
Plxna1 G A 6: 89,357,120 P176S probably benign Het
Pnn A G 12: 59,070,437 K238R probably damaging Het
Pou5f1 A G 17: 35,510,036 E231G probably benign Het
Ppara A T 15: 85,797,876 M258L probably benign Het
Prune2 G A 19: 17,120,518 D1129N probably damaging Het
Rai14 G A 15: 10,633,163 T47M probably damaging Het
Rdh5 T C 10: 128,918,100 I117V probably benign Het
Rpain G A 11: 70,973,898 C137Y probably damaging Het
Scn3a A G 2: 65,530,810 V126A possibly damaging Het
Senp7 G T 16: 56,111,726 L129F probably damaging Het
Setd1a A G 7: 127,791,227 D1025G unknown Het
Sirt4 A T 5: 115,483,023 V30E probably damaging Het
Slit1 C A 19: 41,727,073 R113L probably damaging Het
Stxbp5l G A 16: 37,208,054 T549I noncoding transcript Het
Sytl2 A G 7: 90,409,470 M926V probably damaging Het
Tgfbr2 C T 9: 116,130,006 W113* probably null Het
Tmem86a A G 7: 47,053,764 Y213C probably damaging Het
Tpo T A 12: 30,104,046 Y220F probably damaging Het
Ttc6 C A 12: 57,673,310 A889E probably damaging Het
Tyw1 A G 5: 130,300,014 D547G probably benign Het
Ubtfl1 A G 9: 18,409,227 K17R probably benign Het
Usp46 T A 5: 74,002,693 I331F probably benign Het
Vmn2r111 T C 17: 22,573,092 H61R probably benign Het
Vwa9 A T 9: 64,973,250 H213L possibly damaging Het
Wdr75 T A 1: 45,822,546 N715K probably benign Het
Zfp772 A T 7: 7,204,097 C198* probably null Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 splice site probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R7976:Ly75 UTSW 2 60365088 missense probably damaging 1.00
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
R8392:Ly75 UTSW 2 60349940 missense probably benign 0.00
R8705:Ly75 UTSW 2 60318385 missense probably damaging 0.98
R8714:Ly75 UTSW 2 60334485 missense probably damaging 1.00
R8798:Ly75 UTSW 2 60323926 missense probably benign 0.32
R8799:Ly75 UTSW 2 60348441 missense probably damaging 1.00
R8834:Ly75 UTSW 2 60331089 missense probably benign
R8990:Ly75 UTSW 2 60358559 missense probably benign 0.10
R9015:Ly75 UTSW 2 60316098 missense probably benign
R9547:Ly75 UTSW 2 60330725 critical splice donor site probably null
R9628:Ly75 UTSW 2 60327941 missense probably damaging 1.00
R9659:Ly75 UTSW 2 60338321 missense probably damaging 1.00
R9660:Ly75 UTSW 2 60323840 missense probably damaging 1.00
R9747:Ly75 UTSW 2 60306328 critical splice donor site probably null
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGCACCATTAAACATGTGCTC -3'
(R):5'- GTCGTCTGTGTAAGCGCATATAG -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
(R):5'- CTGTGTAAGCGCATATAGTTTCAG -3'
Posted On 2020-07-13