Incidental Mutation 'R8171:Ly75'
ID 634083
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission 067597-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8171 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60122447-60213617 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 60144572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1297 (T1297I)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect possibly damaging
Transcript: ENSMUST00000028362
AA Change: T1297I

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: T1297I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112533
AA Change: T1297I

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: T1297I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,383,982 (GRCm39) A661E probably benign Het
Abhd14a T A 9: 106,317,960 (GRCm39) T142S probably benign Het
Actn1 A G 12: 80,243,167 (GRCm39) probably null Het
Adss2 T C 1: 177,623,917 (GRCm39) N15S probably benign Het
Alpk2 A G 18: 65,439,054 (GRCm39) S780P probably benign Het
Asap1 G T 15: 63,982,815 (GRCm39) L830M probably damaging Het
Atic T C 1: 71,609,032 (GRCm39) V319A possibly damaging Het
Atp8a2 A T 14: 60,283,493 (GRCm39) I87N probably damaging Het
Bace2 G T 16: 97,225,786 (GRCm39) V407L possibly damaging Het
Bltp1 T C 3: 37,029,862 (GRCm39) V2423A probably benign Het
Bmp3 A T 5: 99,020,528 (GRCm39) Y317F probably damaging Het
Ccdc159 A G 9: 21,845,007 (GRCm39) E291G possibly damaging Het
Cct8l1 T A 5: 25,721,552 (GRCm39) L89Q probably damaging Het
Cep83 T A 10: 94,604,797 (GRCm39) N503K possibly damaging Het
Ces4a A G 8: 105,873,839 (GRCm39) Y436C probably damaging Het
Cftr T A 6: 18,258,287 (GRCm39) D579E probably damaging Het
Chd9 T A 8: 91,752,015 (GRCm39) V1751D possibly damaging Het
Clasp2 A T 9: 113,732,974 (GRCm39) T937S possibly damaging Het
Clock T A 5: 76,414,261 (GRCm39) D17V possibly damaging Het
Cpm T C 10: 117,519,220 (GRCm39) L376P probably damaging Het
Crocc2 T C 1: 93,116,723 (GRCm39) probably null Het
Csnk1g2 A G 10: 80,475,636 (GRCm39) D401G probably damaging Het
Cyb5r4 C T 9: 86,924,863 (GRCm39) L206F possibly damaging Het
Cyp1a1 T A 9: 57,607,479 (GRCm39) W36R probably benign Het
Cyp3a59 A T 5: 146,022,584 (GRCm39) H30L probably damaging Het
Dab2 G A 15: 6,453,407 (GRCm39) V182I probably benign Het
Dnah1 G T 14: 31,019,067 (GRCm39) F1342L probably damaging Het
Draxin A T 4: 148,200,123 (GRCm39) L109Q possibly damaging Het
Elfn1 G A 5: 139,957,112 (GRCm39) V39M probably damaging Het
Erlin1 A G 19: 44,057,768 (GRCm39) I19T probably benign Het
F830016B08Rik T A 18: 60,433,150 (GRCm39) S78T possibly damaging Het
Fer1l4 A G 2: 155,890,151 (GRCm39) V258A probably benign Het
Fgb T C 3: 82,949,822 (GRCm39) D445G probably damaging Het
Fgd6 T C 10: 93,910,194 (GRCm39) probably null Het
Frem3 T A 8: 81,341,869 (GRCm39) D1387E probably damaging Het
Gdf3 T C 6: 122,586,862 (GRCm39) T22A probably benign Het
Glcci1 C T 6: 8,593,167 (GRCm39) A511V probably benign Het
Gldc A T 19: 30,111,161 (GRCm39) N538K probably benign Het
Glipr1l1 C T 10: 111,914,289 (GRCm39) P217S probably benign Het
Gpr161 A G 1: 165,134,005 (GRCm39) N89S probably damaging Het
Gypa T A 8: 81,236,092 (GRCm39) S166T probably benign Het
Hcar1 A G 5: 124,017,152 (GRCm39) S180P probably damaging Het
Hcn1 T C 13: 117,739,270 (GRCm39) S11P unknown Het
Hectd4 A G 5: 121,456,819 (GRCm39) E728G possibly damaging Het
Ints14 A T 9: 64,880,532 (GRCm39) H213L possibly damaging Het
Itih1 A T 14: 30,659,047 (GRCm39) M323K possibly damaging Het
Ivl A G 3: 92,479,085 (GRCm39) S327P probably damaging Het
Kcnt2 T A 1: 140,437,203 (GRCm39) N545K probably benign Het
Kdm4b A T 17: 56,696,534 (GRCm39) R417W probably damaging Het
Kif13a T C 13: 46,932,444 (GRCm39) E1083G probably damaging Het
Klhl40 A T 9: 121,607,623 (GRCm39) H261L probably benign Het
Kpnb1 A G 11: 97,066,573 (GRCm39) probably null Het
Lamc3 C A 2: 31,804,983 (GRCm39) T621N probably benign Het
Lingo3 T C 10: 80,670,595 (GRCm39) H445R probably benign Het
Lypd6 C T 2: 50,080,759 (GRCm39) T149M possibly damaging Het
Mcrs1 A T 15: 99,146,613 (GRCm39) D139E probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Mybpc1 C T 10: 88,358,865 (GRCm39) G1095R probably damaging Het
Myh1 A G 11: 67,093,398 (GRCm39) Y163C probably damaging Het
Notch4 T A 17: 34,801,483 (GRCm39) C1110* probably null Het
Nt5el T A 13: 105,246,291 (GRCm39) V284E probably benign Het
Or12j2 A T 7: 139,916,143 (GRCm39) I123F probably damaging Het
Or2ag1 C T 7: 106,313,825 (GRCm39) S21N probably benign Het
Or2ag1 T A 7: 106,313,826 (GRCm39) S21C Het
Or4c10b A G 2: 89,711,409 (GRCm39) I80V probably benign Het
Pcsk1 T A 13: 75,238,210 (GRCm39) C10* probably null Het
Pdlim5 A T 3: 142,017,948 (GRCm39) S107T probably benign Het
Plac8l1 T A 18: 42,313,445 (GRCm39) D99V probably damaging Het
Plin2 A T 4: 86,575,349 (GRCm39) V400E probably damaging Het
Plxna1 G A 6: 89,334,102 (GRCm39) P176S probably benign Het
Pnn A G 12: 59,117,223 (GRCm39) K238R probably damaging Het
Pou5f1 A G 17: 35,820,933 (GRCm39) E231G probably benign Het
Ppara A T 15: 85,682,077 (GRCm39) M258L probably benign Het
Prune2 G A 19: 17,097,882 (GRCm39) D1129N probably damaging Het
Rai14 G A 15: 10,633,249 (GRCm39) T47M probably damaging Het
Rdh5 T C 10: 128,753,969 (GRCm39) I117V probably benign Het
Rpain G A 11: 70,864,724 (GRCm39) C137Y probably damaging Het
Scn3a A G 2: 65,361,154 (GRCm39) V126A possibly damaging Het
Senp7 G T 16: 55,932,089 (GRCm39) L129F probably damaging Het
Setd1a A G 7: 127,390,399 (GRCm39) D1025G unknown Het
Sirt4 A T 5: 115,621,082 (GRCm39) V30E probably damaging Het
Slit1 C A 19: 41,715,512 (GRCm39) R113L probably damaging Het
Stxbp5l G A 16: 37,028,416 (GRCm39) T549I noncoding transcript Het
Sytl2 A G 7: 90,058,678 (GRCm39) M926V probably damaging Het
Tgfbr2 C T 9: 115,959,074 (GRCm39) W113* probably null Het
Tmem86a A G 7: 46,703,512 (GRCm39) Y213C probably damaging Het
Tpo T A 12: 30,154,045 (GRCm39) Y220F probably damaging Het
Ttc6 C A 12: 57,720,096 (GRCm39) A889E probably damaging Het
Tyw1 A G 5: 130,328,855 (GRCm39) D547G probably benign Het
Ubtfl1 A G 9: 18,320,523 (GRCm39) K17R probably benign Het
Usp46 T A 5: 74,163,354 (GRCm39) I331F probably benign Het
Vmn2r111 T C 17: 22,792,073 (GRCm39) H61R probably benign Het
Wdr75 T A 1: 45,861,706 (GRCm39) N715K probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Zfp772 A T 7: 7,207,096 (GRCm39) C198* probably null Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60,206,421 (GRCm39) missense probably damaging 1.00
IGL01072:Ly75 APN 2 60,184,840 (GRCm39) missense probably damaging 1.00
IGL01409:Ly75 APN 2 60,152,036 (GRCm39) splice site probably null
IGL01432:Ly75 APN 2 60,206,351 (GRCm39) missense probably damaging 1.00
IGL01626:Ly75 APN 2 60,131,359 (GRCm39) missense probably benign 0.13
IGL01690:Ly75 APN 2 60,168,655 (GRCm39) missense probably damaging 1.00
IGL01862:Ly75 APN 2 60,129,516 (GRCm39) missense probably damaging 1.00
IGL01982:Ly75 APN 2 60,142,108 (GRCm39) missense probably damaging 1.00
IGL02075:Ly75 APN 2 60,182,700 (GRCm39) missense probably damaging 0.99
IGL02338:Ly75 APN 2 60,184,796 (GRCm39) missense probably benign 0.04
IGL02364:Ly75 APN 2 60,188,851 (GRCm39) missense probably damaging 1.00
IGL02456:Ly75 APN 2 60,124,125 (GRCm39) missense probably benign 0.09
IGL02474:Ly75 APN 2 60,213,526 (GRCm39) missense probably null 1.00
IGL02608:Ly75 APN 2 60,152,244 (GRCm39) missense probably benign 0.41
IGL02986:Ly75 APN 2 60,138,535 (GRCm39) missense probably damaging 1.00
IGL03015:Ly75 APN 2 60,206,504 (GRCm39) missense probably damaging 1.00
IGL03049:Ly75 APN 2 60,182,414 (GRCm39) missense probably damaging 0.99
euphues UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
four_score UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
lyly UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
Witty UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
D605:Ly75 UTSW 2 60,182,696 (GRCm39) critical splice donor site probably null
R0046:Ly75 UTSW 2 60,169,801 (GRCm39) intron probably benign
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0285:Ly75 UTSW 2 60,148,663 (GRCm39) missense probably damaging 1.00
R0387:Ly75 UTSW 2 60,136,748 (GRCm39) missense probably benign 0.20
R0492:Ly75 UTSW 2 60,138,620 (GRCm39) missense probably damaging 1.00
R0688:Ly75 UTSW 2 60,146,565 (GRCm39) missense probably benign 0.41
R1367:Ly75 UTSW 2 60,124,102 (GRCm39) splice site probably null
R1463:Ly75 UTSW 2 60,199,101 (GRCm39) critical splice donor site probably null
R1581:Ly75 UTSW 2 60,158,237 (GRCm39) missense probably damaging 1.00
R1663:Ly75 UTSW 2 60,144,578 (GRCm39) missense probably damaging 1.00
R1818:Ly75 UTSW 2 60,142,121 (GRCm39) missense probably damaging 1.00
R1881:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R2244:Ly75 UTSW 2 60,180,257 (GRCm39) missense probably benign 0.01
R2905:Ly75 UTSW 2 60,164,898 (GRCm39) missense probably benign 0.00
R3967:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60,183,339 (GRCm39) missense probably damaging 1.00
R4406:Ly75 UTSW 2 60,184,894 (GRCm39) missense probably damaging 1.00
R4526:Ly75 UTSW 2 60,161,117 (GRCm39) missense probably benign 0.09
R4647:Ly75 UTSW 2 60,138,622 (GRCm39) missense probably damaging 1.00
R4795:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4796:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4962:Ly75 UTSW 2 60,182,469 (GRCm39) missense probably damaging 1.00
R4979:Ly75 UTSW 2 60,206,238 (GRCm39) missense probably damaging 1.00
R5072:Ly75 UTSW 2 60,206,307 (GRCm39) missense probably damaging 1.00
R5288:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5373:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60,164,831 (GRCm39) nonsense probably null
R5385:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5395:Ly75 UTSW 2 60,195,455 (GRCm39) missense probably benign 0.41
R5531:Ly75 UTSW 2 60,195,489 (GRCm39) missense probably damaging 0.98
R5662:Ly75 UTSW 2 60,182,725 (GRCm39) missense probably damaging 1.00
R5667:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5668:Ly75 UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
R5671:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5677:Ly75 UTSW 2 60,129,426 (GRCm39) missense probably benign 0.00
R5764:Ly75 UTSW 2 60,148,783 (GRCm39) missense probably benign
R5896:Ly75 UTSW 2 60,213,490 (GRCm39) missense probably benign
R6025:Ly75 UTSW 2 60,206,306 (GRCm39) missense probably damaging 1.00
R6113:Ly75 UTSW 2 60,199,217 (GRCm39) missense probably benign 0.04
R6448:Ly75 UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
R6601:Ly75 UTSW 2 60,148,720 (GRCm39) missense probably benign 0.11
R6745:Ly75 UTSW 2 60,138,523 (GRCm39) missense probably damaging 1.00
R6955:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60,136,749 (GRCm39) missense probably benign
R7100:Ly75 UTSW 2 60,136,778 (GRCm39) missense probably benign
R7110:Ly75 UTSW 2 60,206,528 (GRCm39) missense probably benign 0.31
R7203:Ly75 UTSW 2 60,154,196 (GRCm39) nonsense probably null
R7291:Ly75 UTSW 2 60,160,337 (GRCm39) missense probably damaging 0.98
R7308:Ly75 UTSW 2 60,164,859 (GRCm39) missense probably benign 0.04
R7447:Ly75 UTSW 2 60,164,818 (GRCm39) nonsense probably null
R7512:Ly75 UTSW 2 60,164,907 (GRCm39) missense probably damaging 1.00
R7595:Ly75 UTSW 2 60,124,171 (GRCm39) missense probably benign 0.01
R7976:Ly75 UTSW 2 60,195,432 (GRCm39) missense probably damaging 1.00
R8005:Ly75 UTSW 2 60,163,278 (GRCm39) missense probably damaging 1.00
R8392:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R8705:Ly75 UTSW 2 60,148,729 (GRCm39) missense probably damaging 0.98
R8714:Ly75 UTSW 2 60,164,829 (GRCm39) missense probably damaging 1.00
R8798:Ly75 UTSW 2 60,154,270 (GRCm39) missense probably benign 0.32
R8799:Ly75 UTSW 2 60,178,785 (GRCm39) missense probably damaging 1.00
R8834:Ly75 UTSW 2 60,161,433 (GRCm39) missense probably benign
R8990:Ly75 UTSW 2 60,188,903 (GRCm39) missense probably benign 0.10
R9015:Ly75 UTSW 2 60,146,442 (GRCm39) missense probably benign
R9547:Ly75 UTSW 2 60,161,069 (GRCm39) critical splice donor site probably null
R9628:Ly75 UTSW 2 60,158,285 (GRCm39) missense probably damaging 1.00
R9659:Ly75 UTSW 2 60,168,665 (GRCm39) missense probably damaging 1.00
R9660:Ly75 UTSW 2 60,154,184 (GRCm39) missense probably damaging 1.00
R9747:Ly75 UTSW 2 60,136,672 (GRCm39) critical splice donor site probably null
X0025:Ly75 UTSW 2 60,184,819 (GRCm39) missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60,182,477 (GRCm39) missense possibly damaging 0.65
Z1177:Ly75 UTSW 2 60,180,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACCATTAAACATGTGCTC -3'
(R):5'- GTCGTCTGTGTAAGCGCATATAG -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
(R):5'- CTGTGTAAGCGCATATAGTTTCAG -3'
Posted On 2020-07-13