Incidental Mutation 'R8171:Sytl2'
ID634109
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R8171 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90409470 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 926 (M926V)
Ref Sequence ENSEMBL: ENSMUSP00000139865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107210
AA Change: M886V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616
AA Change: M886V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107211
AA Change: M910V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616
AA Change: M910V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190731
AA Change: M926V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616
AA Change: M926V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190837
AA Change: M899V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616
AA Change: M899V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,025 A661E probably benign Het
4932438A13Rik T C 3: 36,975,713 V2423A probably benign Het
4933425L06Rik T A 13: 105,109,783 V284E probably benign Het
Abhd14a T A 9: 106,440,761 T142S probably benign Het
Actn1 A G 12: 80,196,393 probably null Het
Adss T C 1: 177,796,351 N15S probably benign Het
Alpk2 A G 18: 65,305,983 S780P probably benign Het
Asap1 G T 15: 64,110,966 L830M probably damaging Het
Atic T C 1: 71,569,873 V319A possibly damaging Het
Atp8a2 A T 14: 60,046,044 I87N probably damaging Het
Bace2 G T 16: 97,424,586 V407L possibly damaging Het
Bmp3 A T 5: 98,872,669 Y317F probably damaging Het
Ccdc159 A G 9: 21,933,711 E291G possibly damaging Het
Cct8l1 T A 5: 25,516,554 L89Q probably damaging Het
Cep83 T A 10: 94,768,935 N503K possibly damaging Het
Ces4a A G 8: 105,147,207 Y436C probably damaging Het
Cftr T A 6: 18,258,288 D579E probably damaging Het
Chd9 T A 8: 91,025,387 V1751D possibly damaging Het
Clasp2 A T 9: 113,903,906 T937S possibly damaging Het
Clock T A 5: 76,266,414 D17V possibly damaging Het
Cpm T C 10: 117,683,315 L376P probably damaging Het
Crocc2 T C 1: 93,189,001 probably null Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Cyb5r4 C T 9: 87,042,810 L206F possibly damaging Het
Cyp1a1 T A 9: 57,700,196 W36R probably benign Het
Cyp3a59 A T 5: 146,085,774 H30L probably damaging Het
Dab2 G A 15: 6,423,926 V182I probably benign Het
Dnah1 G T 14: 31,297,110 F1342L probably damaging Het
Draxin A T 4: 148,115,666 L109Q possibly damaging Het
Elfn1 G A 5: 139,971,357 V39M probably damaging Het
Erlin1 A G 19: 44,069,329 I19T probably benign Het
F830016B08Rik T A 18: 60,300,078 S78T possibly damaging Het
Fer1l4 A G 2: 156,048,231 V258A probably benign Het
Fgb T C 3: 83,042,515 D445G probably damaging Het
Fgd6 T C 10: 94,074,332 probably null Het
Frem3 T A 8: 80,615,240 D1387E probably damaging Het
Gdf3 T C 6: 122,609,903 T22A probably benign Het
Glcci1 C T 6: 8,593,167 A511V probably benign Het
Gldc A T 19: 30,133,761 N538K probably benign Het
Glipr1l1 C T 10: 112,078,384 P217S probably benign Het
Gm15800 A G 5: 121,318,756 E728G possibly damaging Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr161 A G 1: 165,306,436 N89S probably damaging Het
Gypa T A 8: 80,509,463 S166T probably benign Het
Hcar1 A G 5: 123,879,089 S180P probably damaging Het
Hcn1 T C 13: 117,602,734 S11P unknown Het
Itih1 A T 14: 30,937,090 M323K possibly damaging Het
Ivl A G 3: 92,571,778 S327P probably damaging Het
Kcnt2 T A 1: 140,509,465 N545K probably benign Het
Kdm4b A T 17: 56,389,534 R417W probably damaging Het
Kif13a T C 13: 46,778,968 E1083G probably damaging Het
Klhl40 A T 9: 121,778,557 H261L probably benign Het
Kpnb1 A G 11: 97,175,747 probably null Het
Lamc3 C A 2: 31,914,971 T621N probably benign Het
Lingo3 T C 10: 80,834,761 H445R probably benign Het
Ly75 G A 2: 60,314,228 T1297I possibly damaging Het
Lypd6 C T 2: 50,190,747 T149M possibly damaging Het
Mcrs1 A T 15: 99,248,732 D139E probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Mybpc1 C T 10: 88,523,003 G1095R probably damaging Het
Myh1 A G 11: 67,202,572 Y163C probably damaging Het
Notch4 T A 17: 34,582,509 C1110* probably null Het
Olfr1257 A G 2: 89,881,065 I80V probably benign Het
Olfr527 A T 7: 140,336,230 I123F probably damaging Het
Olfr705 C T 7: 106,714,618 S21N probably benign Het
Olfr705 T A 7: 106,714,619 S21C Het
Pcsk1 T A 13: 75,090,091 C10* probably null Het
Pdlim5 A T 3: 142,312,187 S107T probably benign Het
Plac8l1 T A 18: 42,180,380 D99V probably damaging Het
Plin2 A T 4: 86,657,112 V400E probably damaging Het
Plxna1 G A 6: 89,357,120 P176S probably benign Het
Pnn A G 12: 59,070,437 K238R probably damaging Het
Pou5f1 A G 17: 35,510,036 E231G probably benign Het
Ppara A T 15: 85,797,876 M258L probably benign Het
Prune2 G A 19: 17,120,518 D1129N probably damaging Het
Rai14 G A 15: 10,633,163 T47M probably damaging Het
Rdh5 T C 10: 128,918,100 I117V probably benign Het
Rpain G A 11: 70,973,898 C137Y probably damaging Het
Scn3a A G 2: 65,530,810 V126A possibly damaging Het
Senp7 G T 16: 56,111,726 L129F probably damaging Het
Setd1a A G 7: 127,791,227 D1025G unknown Het
Sirt4 A T 5: 115,483,023 V30E probably damaging Het
Slit1 C A 19: 41,727,073 R113L probably damaging Het
Stxbp5l G A 16: 37,208,054 T549I noncoding transcript Het
Tgfbr2 C T 9: 116,130,006 W113* probably null Het
Tmem86a A G 7: 47,053,764 Y213C probably damaging Het
Tpo T A 12: 30,104,046 Y220F probably damaging Het
Ttc6 C A 12: 57,673,310 A889E probably damaging Het
Tyw1 A G 5: 130,300,014 D547G probably benign Het
Ubtfl1 A G 9: 18,409,227 K17R probably benign Het
Usp46 T A 5: 74,002,693 I331F probably benign Het
Vmn2r111 T C 17: 22,573,092 H61R probably benign Het
Vwa9 A T 9: 64,973,250 H213L possibly damaging Het
Wdr75 T A 1: 45,822,546 N715K probably benign Het
Zfp772 A T 7: 7,204,097 C198* probably null Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0269:Sytl2 UTSW 7 90403020 splice site probably benign
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R3952:Sytl2 UTSW 7 90381492 intron probably benign
R4082:Sytl2 UTSW 7 90408427 missense possibly damaging 0.88
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4730:Sytl2 UTSW 7 90381249 intron probably benign
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5096:Sytl2 UTSW 7 90376082 missense possibly damaging 0.49
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R5792:Sytl2 UTSW 7 90375689 missense probably damaging 0.98
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
R8127:Sytl2 UTSW 7 90375590 missense possibly damaging 0.93
R8225:Sytl2 UTSW 7 90375517 missense probably benign 0.36
R8297:Sytl2 UTSW 7 90385075 missense probably benign
R8843:Sytl2 UTSW 7 90376126 missense probably benign 0.03
R8929:Sytl2 UTSW 7 90375602 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCGACCTGCGTAGTAAACTAG -3'
(R):5'- TGCAGATTAAGTTGAGCATGCTTC -3'

Sequencing Primer
(F):5'- GACCTGCGTAGTAAACTAGTTCTTC -3'
(R):5'- AGTTGAGCATGCTTCTAAAAGTC -3'
Posted On2020-07-13