Incidental Mutation 'R8171:Clasp2'
ID 634125
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene Name CLIP associating protein 2
Synonyms 1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
MMRRC Submission 067597-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8171 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 113741473-113919682 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113903906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 937 (T937S)
Ref Sequence ENSEMBL: ENSMUSP00000107469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000111838
AA Change: T937S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: T937S

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163895
AA Change: T958S

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: T958S

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166734
AA Change: T938S

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: T938S

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,025 A661E probably benign Het
4932438A13Rik T C 3: 36,975,713 V2423A probably benign Het
4933425L06Rik T A 13: 105,109,783 V284E probably benign Het
Abhd14a T A 9: 106,440,761 T142S probably benign Het
Actn1 A G 12: 80,196,393 probably null Het
Adss T C 1: 177,796,351 N15S probably benign Het
Alpk2 A G 18: 65,305,983 S780P probably benign Het
Asap1 G T 15: 64,110,966 L830M probably damaging Het
Atic T C 1: 71,569,873 V319A possibly damaging Het
Atp8a2 A T 14: 60,046,044 I87N probably damaging Het
Bace2 G T 16: 97,424,586 V407L possibly damaging Het
Bmp3 A T 5: 98,872,669 Y317F probably damaging Het
Ccdc159 A G 9: 21,933,711 E291G possibly damaging Het
Cct8l1 T A 5: 25,516,554 L89Q probably damaging Het
Cep83 T A 10: 94,768,935 N503K possibly damaging Het
Ces4a A G 8: 105,147,207 Y436C probably damaging Het
Cftr T A 6: 18,258,288 D579E probably damaging Het
Chd9 T A 8: 91,025,387 V1751D possibly damaging Het
Clock T A 5: 76,266,414 D17V possibly damaging Het
Cpm T C 10: 117,683,315 L376P probably damaging Het
Crocc2 T C 1: 93,189,001 probably null Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Cyb5r4 C T 9: 87,042,810 L206F possibly damaging Het
Cyp1a1 T A 9: 57,700,196 W36R probably benign Het
Cyp3a59 A T 5: 146,085,774 H30L probably damaging Het
Dab2 G A 15: 6,423,926 V182I probably benign Het
Dnah1 G T 14: 31,297,110 F1342L probably damaging Het
Draxin A T 4: 148,115,666 L109Q possibly damaging Het
Elfn1 G A 5: 139,971,357 V39M probably damaging Het
Erlin1 A G 19: 44,069,329 I19T probably benign Het
F830016B08Rik T A 18: 60,300,078 S78T possibly damaging Het
Fer1l4 A G 2: 156,048,231 V258A probably benign Het
Fgb T C 3: 83,042,515 D445G probably damaging Het
Fgd6 T C 10: 94,074,332 probably null Het
Frem3 T A 8: 80,615,240 D1387E probably damaging Het
Gdf3 T C 6: 122,609,903 T22A probably benign Het
Glcci1 C T 6: 8,593,167 A511V probably benign Het
Gldc A T 19: 30,133,761 N538K probably benign Het
Glipr1l1 C T 10: 112,078,384 P217S probably benign Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr161 A G 1: 165,306,436 N89S probably damaging Het
Gypa T A 8: 80,509,463 S166T probably benign Het
Hcar1 A G 5: 123,879,089 S180P probably damaging Het
Hcn1 T C 13: 117,602,734 S11P unknown Het
Hectd4 A G 5: 121,318,756 E728G possibly damaging Het
Ints14 A T 9: 64,973,250 H213L possibly damaging Het
Itih1 A T 14: 30,937,090 M323K possibly damaging Het
Ivl A G 3: 92,571,778 S327P probably damaging Het
Kcnt2 T A 1: 140,509,465 N545K probably benign Het
Kdm4b A T 17: 56,389,534 R417W probably damaging Het
Kif13a T C 13: 46,778,968 E1083G probably damaging Het
Klhl40 A T 9: 121,778,557 H261L probably benign Het
Kpnb1 A G 11: 97,175,747 probably null Het
Lamc3 C A 2: 31,914,971 T621N probably benign Het
Lingo3 T C 10: 80,834,761 H445R probably benign Het
Ly75 G A 2: 60,314,228 T1297I possibly damaging Het
Lypd6 C T 2: 50,190,747 T149M possibly damaging Het
Mcrs1 A T 15: 99,248,732 D139E probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Mybpc1 C T 10: 88,523,003 G1095R probably damaging Het
Myh1 A G 11: 67,202,572 Y163C probably damaging Het
Notch4 T A 17: 34,582,509 C1110* probably null Het
Olfr1257 A G 2: 89,881,065 I80V probably benign Het
Olfr527 A T 7: 140,336,230 I123F probably damaging Het
Olfr705 C T 7: 106,714,618 S21N probably benign Het
Olfr705 T A 7: 106,714,619 S21C Het
Pcsk1 T A 13: 75,090,091 C10* probably null Het
Pdlim5 A T 3: 142,312,187 S107T probably benign Het
Plac8l1 T A 18: 42,180,380 D99V probably damaging Het
Plin2 A T 4: 86,657,112 V400E probably damaging Het
Plxna1 G A 6: 89,357,120 P176S probably benign Het
Pnn A G 12: 59,070,437 K238R probably damaging Het
Pou5f1 A G 17: 35,510,036 E231G probably benign Het
Ppara A T 15: 85,797,876 M258L probably benign Het
Prune2 G A 19: 17,120,518 D1129N probably damaging Het
Rai14 G A 15: 10,633,163 T47M probably damaging Het
Rdh5 T C 10: 128,918,100 I117V probably benign Het
Rpain G A 11: 70,973,898 C137Y probably damaging Het
Scn3a A G 2: 65,530,810 V126A possibly damaging Het
Senp7 G T 16: 56,111,726 L129F probably damaging Het
Setd1a A G 7: 127,791,227 D1025G unknown Het
Sirt4 A T 5: 115,483,023 V30E probably damaging Het
Slit1 C A 19: 41,727,073 R113L probably damaging Het
Stxbp5l G A 16: 37,208,054 T549I noncoding transcript Het
Sytl2 A G 7: 90,409,470 M926V probably damaging Het
Tgfbr2 C T 9: 116,130,006 W113* probably null Het
Tmem86a A G 7: 47,053,764 Y213C probably damaging Het
Tpo T A 12: 30,104,046 Y220F probably damaging Het
Ttc6 C A 12: 57,673,310 A889E probably damaging Het
Tyw1 A G 5: 130,300,014 D547G probably benign Het
Ubtfl1 A G 9: 18,409,227 K17R probably benign Het
Usp46 T A 5: 74,002,693 I331F probably benign Het
Vmn2r111 T C 17: 22,573,092 H61R probably benign Het
Wdr75 T A 1: 45,822,546 N715K probably benign Het
Zfp772 A T 7: 7,204,097 C198* probably null Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113905992 splice site probably benign
IGL00885:Clasp2 APN 9 113911416 missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113906127 missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113813292 splice site probably null
IGL01567:Clasp2 APN 9 113880096 missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113880020 missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113879989 missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113868726 splice site probably benign
IGL02635:Clasp2 APN 9 113908842 missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113890061 missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113906136 missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113844140 nonsense probably null
IGL03219:Clasp2 APN 9 113848477 splice site probably benign
PIT4810001:Clasp2 UTSW 9 113906067 missense probably damaging 1.00
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0421:Clasp2 UTSW 9 113854302 missense probably benign 0.02
R0432:Clasp2 UTSW 9 113909419 missense probably benign 0.00
R0458:Clasp2 UTSW 9 113906224 splice site probably null
R0865:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113847705 missense possibly damaging 0.58
R1037:Clasp2 UTSW 9 113896634 splice site probably benign
R1925:Clasp2 UTSW 9 113906197 missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113906157 missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113876304 missense probably damaging 1.00
R2568:Clasp2 UTSW 9 113878764 missense probably benign
R3011:Clasp2 UTSW 9 113901513 missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113889961 missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113908737 missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113906105 missense probably benign 0.28
R4323:Clasp2 UTSW 9 113889959 missense possibly damaging 0.91
R4571:Clasp2 UTSW 9 113847721 missense probably damaging 1.00
R4975:Clasp2 UTSW 9 113903916 missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113903946 missense probably damaging 1.00
R5564:Clasp2 UTSW 9 113812768 critical splice donor site probably null
R5697:Clasp2 UTSW 9 113860122 missense probably benign 0.01
R5780:Clasp2 UTSW 9 113850152 missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113862242 missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113876247 missense probably benign 0.07
R6026:Clasp2 UTSW 9 113911578 missense probably benign 0.13
R6090:Clasp2 UTSW 9 113852735 missense probably benign 0.06
R6262:Clasp2 UTSW 9 113876352 critical splice donor site probably null
R6427:Clasp2 UTSW 9 113892444 missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113773717 missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113813264 missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113896720 missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113875270 nonsense probably null
R7032:Clasp2 UTSW 9 113854323 missense probably benign 0.04
R7165:Clasp2 UTSW 9 113786399 splice site probably null
R7221:Clasp2 UTSW 9 113852757 missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113876353 splice site probably null
R7583:Clasp2 UTSW 9 113908687 missense probably benign 0.02
R7774:Clasp2 UTSW 9 113848736 splice site probably null
R7895:Clasp2 UTSW 9 113903948 missense probably benign 0.03
R8084:Clasp2 UTSW 9 113847755 missense probably benign 0.16
R8109:Clasp2 UTSW 9 113911520 missense probably damaging 1.00
R8230:Clasp2 UTSW 9 113892414 missense possibly damaging 0.73
R8810:Clasp2 UTSW 9 113899581 missense probably damaging 1.00
R8879:Clasp2 UTSW 9 113773705 missense probably benign 0.39
R8888:Clasp2 UTSW 9 113903868 missense possibly damaging 0.54
R8889:Clasp2 UTSW 9 113880183 missense probably damaging 1.00
R8892:Clasp2 UTSW 9 113880183 missense probably damaging 1.00
R8922:Clasp2 UTSW 9 113896660 nonsense probably null
R9042:Clasp2 UTSW 9 113905997 missense probably benign
R9195:Clasp2 UTSW 9 113841977 missense probably benign 0.06
R9355:Clasp2 UTSW 9 113835241 missense probably damaging 1.00
R9481:Clasp2 UTSW 9 113841601 missense probably damaging 1.00
R9502:Clasp2 UTSW 9 113908798 missense probably benign 0.01
R9523:Clasp2 UTSW 9 113876304 missense probably damaging 0.98
R9525:Clasp2 UTSW 9 113911609 missense probably damaging 1.00
R9653:Clasp2 UTSW 9 113841925 missense probably benign 0.01
R9699:Clasp2 UTSW 9 113909546 critical splice donor site probably null
R9738:Clasp2 UTSW 9 113761597 nonsense probably null
R9775:Clasp2 UTSW 9 113896672 missense probably benign
X0022:Clasp2 UTSW 9 113852672 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113770221 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113908795 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAGATGTGGTTATTTCAGC -3'
(R):5'- CTTGGAGAGTGACTTAAGCTTCTAAAG -3'

Sequencing Primer
(F):5'- AGCATACATACGCTGGCAG -3'
(R):5'- TATATGAACACACCAGAAAGCAAAG -3'
Posted On 2020-07-13