Incidental Mutation 'R8171:Mybpc1'
ID 634130
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms Slow-type C-protein, 8030451F13Rik
MMRRC Submission 067597-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R8171 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 88354141-88441014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88358865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1095 (G1095R)
Ref Sequence ENSEMBL: ENSMUSP00000112699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably damaging
Transcript: ENSMUST00000119185
AA Change: G1095R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: G1095R

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121629
AA Change: G1109R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: G1109R

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122472
Gene: ENSMUSG00000020061
AA Change: G347R

DomainStartEndE-ValueType
PDB:2YUW|A 2 52 2e-25 PDB
low complexity region 53 65 N/A INTRINSIC
IG 68 151 9.06e-2 SMART
FN3 154 236 2.06e-12 SMART
IGc2 281 348 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156573
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,383,982 (GRCm39) A661E probably benign Het
Abhd14a T A 9: 106,317,960 (GRCm39) T142S probably benign Het
Actn1 A G 12: 80,243,167 (GRCm39) probably null Het
Adss2 T C 1: 177,623,917 (GRCm39) N15S probably benign Het
Alpk2 A G 18: 65,439,054 (GRCm39) S780P probably benign Het
Asap1 G T 15: 63,982,815 (GRCm39) L830M probably damaging Het
Atic T C 1: 71,609,032 (GRCm39) V319A possibly damaging Het
Atp8a2 A T 14: 60,283,493 (GRCm39) I87N probably damaging Het
Bace2 G T 16: 97,225,786 (GRCm39) V407L possibly damaging Het
Bltp1 T C 3: 37,029,862 (GRCm39) V2423A probably benign Het
Bmp3 A T 5: 99,020,528 (GRCm39) Y317F probably damaging Het
Ccdc159 A G 9: 21,845,007 (GRCm39) E291G possibly damaging Het
Cct8l1 T A 5: 25,721,552 (GRCm39) L89Q probably damaging Het
Cep83 T A 10: 94,604,797 (GRCm39) N503K possibly damaging Het
Ces4a A G 8: 105,873,839 (GRCm39) Y436C probably damaging Het
Cftr T A 6: 18,258,287 (GRCm39) D579E probably damaging Het
Chd9 T A 8: 91,752,015 (GRCm39) V1751D possibly damaging Het
Clasp2 A T 9: 113,732,974 (GRCm39) T937S possibly damaging Het
Clock T A 5: 76,414,261 (GRCm39) D17V possibly damaging Het
Cpm T C 10: 117,519,220 (GRCm39) L376P probably damaging Het
Crocc2 T C 1: 93,116,723 (GRCm39) probably null Het
Csnk1g2 A G 10: 80,475,636 (GRCm39) D401G probably damaging Het
Cyb5r4 C T 9: 86,924,863 (GRCm39) L206F possibly damaging Het
Cyp1a1 T A 9: 57,607,479 (GRCm39) W36R probably benign Het
Cyp3a59 A T 5: 146,022,584 (GRCm39) H30L probably damaging Het
Dab2 G A 15: 6,453,407 (GRCm39) V182I probably benign Het
Dnah1 G T 14: 31,019,067 (GRCm39) F1342L probably damaging Het
Draxin A T 4: 148,200,123 (GRCm39) L109Q possibly damaging Het
Elfn1 G A 5: 139,957,112 (GRCm39) V39M probably damaging Het
Erlin1 A G 19: 44,057,768 (GRCm39) I19T probably benign Het
F830016B08Rik T A 18: 60,433,150 (GRCm39) S78T possibly damaging Het
Fer1l4 A G 2: 155,890,151 (GRCm39) V258A probably benign Het
Fgb T C 3: 82,949,822 (GRCm39) D445G probably damaging Het
Fgd6 T C 10: 93,910,194 (GRCm39) probably null Het
Frem3 T A 8: 81,341,869 (GRCm39) D1387E probably damaging Het
Gdf3 T C 6: 122,586,862 (GRCm39) T22A probably benign Het
Glcci1 C T 6: 8,593,167 (GRCm39) A511V probably benign Het
Gldc A T 19: 30,111,161 (GRCm39) N538K probably benign Het
Glipr1l1 C T 10: 111,914,289 (GRCm39) P217S probably benign Het
Gpr161 A G 1: 165,134,005 (GRCm39) N89S probably damaging Het
Gypa T A 8: 81,236,092 (GRCm39) S166T probably benign Het
Hcar1 A G 5: 124,017,152 (GRCm39) S180P probably damaging Het
Hcn1 T C 13: 117,739,270 (GRCm39) S11P unknown Het
Hectd4 A G 5: 121,456,819 (GRCm39) E728G possibly damaging Het
Ints14 A T 9: 64,880,532 (GRCm39) H213L possibly damaging Het
Itih1 A T 14: 30,659,047 (GRCm39) M323K possibly damaging Het
Ivl A G 3: 92,479,085 (GRCm39) S327P probably damaging Het
Kcnt2 T A 1: 140,437,203 (GRCm39) N545K probably benign Het
Kdm4b A T 17: 56,696,534 (GRCm39) R417W probably damaging Het
Kif13a T C 13: 46,932,444 (GRCm39) E1083G probably damaging Het
Klhl40 A T 9: 121,607,623 (GRCm39) H261L probably benign Het
Kpnb1 A G 11: 97,066,573 (GRCm39) probably null Het
Lamc3 C A 2: 31,804,983 (GRCm39) T621N probably benign Het
Lingo3 T C 10: 80,670,595 (GRCm39) H445R probably benign Het
Ly75 G A 2: 60,144,572 (GRCm39) T1297I possibly damaging Het
Lypd6 C T 2: 50,080,759 (GRCm39) T149M possibly damaging Het
Mcrs1 A T 15: 99,146,613 (GRCm39) D139E probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Myh1 A G 11: 67,093,398 (GRCm39) Y163C probably damaging Het
Notch4 T A 17: 34,801,483 (GRCm39) C1110* probably null Het
Nt5el T A 13: 105,246,291 (GRCm39) V284E probably benign Het
Or12j2 A T 7: 139,916,143 (GRCm39) I123F probably damaging Het
Or2ag1 C T 7: 106,313,825 (GRCm39) S21N probably benign Het
Or2ag1 T A 7: 106,313,826 (GRCm39) S21C Het
Or4c10b A G 2: 89,711,409 (GRCm39) I80V probably benign Het
Pcsk1 T A 13: 75,238,210 (GRCm39) C10* probably null Het
Pdlim5 A T 3: 142,017,948 (GRCm39) S107T probably benign Het
Plac8l1 T A 18: 42,313,445 (GRCm39) D99V probably damaging Het
Plin2 A T 4: 86,575,349 (GRCm39) V400E probably damaging Het
Plxna1 G A 6: 89,334,102 (GRCm39) P176S probably benign Het
Pnn A G 12: 59,117,223 (GRCm39) K238R probably damaging Het
Pou5f1 A G 17: 35,820,933 (GRCm39) E231G probably benign Het
Ppara A T 15: 85,682,077 (GRCm39) M258L probably benign Het
Prune2 G A 19: 17,097,882 (GRCm39) D1129N probably damaging Het
Rai14 G A 15: 10,633,249 (GRCm39) T47M probably damaging Het
Rdh5 T C 10: 128,753,969 (GRCm39) I117V probably benign Het
Rpain G A 11: 70,864,724 (GRCm39) C137Y probably damaging Het
Scn3a A G 2: 65,361,154 (GRCm39) V126A possibly damaging Het
Senp7 G T 16: 55,932,089 (GRCm39) L129F probably damaging Het
Setd1a A G 7: 127,390,399 (GRCm39) D1025G unknown Het
Sirt4 A T 5: 115,621,082 (GRCm39) V30E probably damaging Het
Slit1 C A 19: 41,715,512 (GRCm39) R113L probably damaging Het
Stxbp5l G A 16: 37,028,416 (GRCm39) T549I noncoding transcript Het
Sytl2 A G 7: 90,058,678 (GRCm39) M926V probably damaging Het
Tgfbr2 C T 9: 115,959,074 (GRCm39) W113* probably null Het
Tmem86a A G 7: 46,703,512 (GRCm39) Y213C probably damaging Het
Tpo T A 12: 30,154,045 (GRCm39) Y220F probably damaging Het
Ttc6 C A 12: 57,720,096 (GRCm39) A889E probably damaging Het
Tyw1 A G 5: 130,328,855 (GRCm39) D547G probably benign Het
Ubtfl1 A G 9: 18,320,523 (GRCm39) K17R probably benign Het
Usp46 T A 5: 74,163,354 (GRCm39) I331F probably benign Het
Vmn2r111 T C 17: 22,792,073 (GRCm39) H61R probably benign Het
Wdr75 T A 1: 45,861,706 (GRCm39) N715K probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Zfp772 A T 7: 7,207,096 (GRCm39) C198* probably null Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88,385,124 (GRCm39) missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88,372,246 (GRCm39) missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88,360,970 (GRCm39) splice site probably null
IGL00964:Mybpc1 APN 10 88,391,604 (GRCm39) critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88,406,507 (GRCm39) missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88,367,632 (GRCm39) missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88,372,290 (GRCm39) missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88,362,235 (GRCm39) missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88,376,822 (GRCm39) missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88,407,378 (GRCm39) splice site probably benign
R1321:Mybpc1 UTSW 10 88,406,463 (GRCm39) missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88,365,403 (GRCm39) missense possibly damaging 0.85
R1562:Mybpc1 UTSW 10 88,389,193 (GRCm39) missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88,389,157 (GRCm39) missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88,384,688 (GRCm39) missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88,387,404 (GRCm39) missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88,381,921 (GRCm39) missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88,409,299 (GRCm39) nonsense probably null
R2129:Mybpc1 UTSW 10 88,387,314 (GRCm39) missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88,376,804 (GRCm39) splice site probably benign
R2200:Mybpc1 UTSW 10 88,391,557 (GRCm39) missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88,391,540 (GRCm39) missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88,387,269 (GRCm39) missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88,367,641 (GRCm39) missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88,406,521 (GRCm39) splice site probably null
R4032:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88,409,387 (GRCm39) nonsense probably null
R4821:Mybpc1 UTSW 10 88,384,727 (GRCm39) missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R4876:Mybpc1 UTSW 10 88,358,853 (GRCm39) missense probably benign
R4878:Mybpc1 UTSW 10 88,387,292 (GRCm39) missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88,391,586 (GRCm39) nonsense probably null
R4913:Mybpc1 UTSW 10 88,389,116 (GRCm39) critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88,391,525 (GRCm39) missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88,379,636 (GRCm39) missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88,381,926 (GRCm39) missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88,372,213 (GRCm39) missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88,358,876 (GRCm39) missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88,381,891 (GRCm39) missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88,406,428 (GRCm39) missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88,378,318 (GRCm39) missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88,404,481 (GRCm39) missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88,396,217 (GRCm39) missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88,389,139 (GRCm39) missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88,358,861 (GRCm39) missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88,372,243 (GRCm39) missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88,378,192 (GRCm39) nonsense probably null
R6972:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88,358,886 (GRCm39) missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88,389,274 (GRCm39) missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88,379,581 (GRCm39) missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88,385,209 (GRCm39) missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88,362,155 (GRCm39) missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88,385,187 (GRCm39) missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88,384,716 (GRCm39) missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88,378,234 (GRCm39) missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88,394,529 (GRCm39) missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88,394,553 (GRCm39) missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88,409,359 (GRCm39) nonsense probably null
R8494:Mybpc1 UTSW 10 88,362,291 (GRCm39) missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88,407,447 (GRCm39) missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88,394,437 (GRCm39) missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88,358,906 (GRCm39) missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88,391,501 (GRCm39) missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88,389,168 (GRCm39) missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88,379,615 (GRCm39) missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88,360,829 (GRCm39) critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88,372,197 (GRCm39) missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88,379,624 (GRCm39) missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88,372,257 (GRCm39) missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88,406,497 (GRCm39) missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88,396,189 (GRCm39) missense probably benign
Z1177:Mybpc1 UTSW 10 88,409,299 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACAGAGGCAGAGGTGTCC -3'
(R):5'- GCTTTTAAATCCCACTGCTGG -3'

Sequencing Primer
(F):5'- AGAGGTGTCCTGTCTGTCCC -3'
(R):5'- ACATCGTAGGCTTTGACTTGAC -3'
Posted On 2020-07-13