Incidental Mutation 'R8171:Fgd6'
ID 634131
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene Name FYVE, RhoGEF and PH domain containing 6
Synonyms Etohd4, ZFYVE24
MMRRC Submission 067597-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.413) question?
Stock # R8171 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93871863-93981201 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 93910194 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
AlphaFold Q69ZL1
PDB Structure Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000020208
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,383,982 (GRCm39) A661E probably benign Het
Abhd14a T A 9: 106,317,960 (GRCm39) T142S probably benign Het
Actn1 A G 12: 80,243,167 (GRCm39) probably null Het
Adss2 T C 1: 177,623,917 (GRCm39) N15S probably benign Het
Alpk2 A G 18: 65,439,054 (GRCm39) S780P probably benign Het
Asap1 G T 15: 63,982,815 (GRCm39) L830M probably damaging Het
Atic T C 1: 71,609,032 (GRCm39) V319A possibly damaging Het
Atp8a2 A T 14: 60,283,493 (GRCm39) I87N probably damaging Het
Bace2 G T 16: 97,225,786 (GRCm39) V407L possibly damaging Het
Bltp1 T C 3: 37,029,862 (GRCm39) V2423A probably benign Het
Bmp3 A T 5: 99,020,528 (GRCm39) Y317F probably damaging Het
Ccdc159 A G 9: 21,845,007 (GRCm39) E291G possibly damaging Het
Cct8l1 T A 5: 25,721,552 (GRCm39) L89Q probably damaging Het
Cep83 T A 10: 94,604,797 (GRCm39) N503K possibly damaging Het
Ces4a A G 8: 105,873,839 (GRCm39) Y436C probably damaging Het
Cftr T A 6: 18,258,287 (GRCm39) D579E probably damaging Het
Chd9 T A 8: 91,752,015 (GRCm39) V1751D possibly damaging Het
Clasp2 A T 9: 113,732,974 (GRCm39) T937S possibly damaging Het
Clock T A 5: 76,414,261 (GRCm39) D17V possibly damaging Het
Cpm T C 10: 117,519,220 (GRCm39) L376P probably damaging Het
Crocc2 T C 1: 93,116,723 (GRCm39) probably null Het
Csnk1g2 A G 10: 80,475,636 (GRCm39) D401G probably damaging Het
Cyb5r4 C T 9: 86,924,863 (GRCm39) L206F possibly damaging Het
Cyp1a1 T A 9: 57,607,479 (GRCm39) W36R probably benign Het
Cyp3a59 A T 5: 146,022,584 (GRCm39) H30L probably damaging Het
Dab2 G A 15: 6,453,407 (GRCm39) V182I probably benign Het
Dnah1 G T 14: 31,019,067 (GRCm39) F1342L probably damaging Het
Draxin A T 4: 148,200,123 (GRCm39) L109Q possibly damaging Het
Elfn1 G A 5: 139,957,112 (GRCm39) V39M probably damaging Het
Erlin1 A G 19: 44,057,768 (GRCm39) I19T probably benign Het
F830016B08Rik T A 18: 60,433,150 (GRCm39) S78T possibly damaging Het
Fer1l4 A G 2: 155,890,151 (GRCm39) V258A probably benign Het
Fgb T C 3: 82,949,822 (GRCm39) D445G probably damaging Het
Frem3 T A 8: 81,341,869 (GRCm39) D1387E probably damaging Het
Gdf3 T C 6: 122,586,862 (GRCm39) T22A probably benign Het
Glcci1 C T 6: 8,593,167 (GRCm39) A511V probably benign Het
Gldc A T 19: 30,111,161 (GRCm39) N538K probably benign Het
Glipr1l1 C T 10: 111,914,289 (GRCm39) P217S probably benign Het
Gpr161 A G 1: 165,134,005 (GRCm39) N89S probably damaging Het
Gypa T A 8: 81,236,092 (GRCm39) S166T probably benign Het
Hcar1 A G 5: 124,017,152 (GRCm39) S180P probably damaging Het
Hcn1 T C 13: 117,739,270 (GRCm39) S11P unknown Het
Hectd4 A G 5: 121,456,819 (GRCm39) E728G possibly damaging Het
Ints14 A T 9: 64,880,532 (GRCm39) H213L possibly damaging Het
Itih1 A T 14: 30,659,047 (GRCm39) M323K possibly damaging Het
Ivl A G 3: 92,479,085 (GRCm39) S327P probably damaging Het
Kcnt2 T A 1: 140,437,203 (GRCm39) N545K probably benign Het
Kdm4b A T 17: 56,696,534 (GRCm39) R417W probably damaging Het
Kif13a T C 13: 46,932,444 (GRCm39) E1083G probably damaging Het
Klhl40 A T 9: 121,607,623 (GRCm39) H261L probably benign Het
Kpnb1 A G 11: 97,066,573 (GRCm39) probably null Het
Lamc3 C A 2: 31,804,983 (GRCm39) T621N probably benign Het
Lingo3 T C 10: 80,670,595 (GRCm39) H445R probably benign Het
Ly75 G A 2: 60,144,572 (GRCm39) T1297I possibly damaging Het
Lypd6 C T 2: 50,080,759 (GRCm39) T149M possibly damaging Het
Mcrs1 A T 15: 99,146,613 (GRCm39) D139E probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Mybpc1 C T 10: 88,358,865 (GRCm39) G1095R probably damaging Het
Myh1 A G 11: 67,093,398 (GRCm39) Y163C probably damaging Het
Notch4 T A 17: 34,801,483 (GRCm39) C1110* probably null Het
Nt5el T A 13: 105,246,291 (GRCm39) V284E probably benign Het
Or12j2 A T 7: 139,916,143 (GRCm39) I123F probably damaging Het
Or2ag1 C T 7: 106,313,825 (GRCm39) S21N probably benign Het
Or2ag1 T A 7: 106,313,826 (GRCm39) S21C Het
Or4c10b A G 2: 89,711,409 (GRCm39) I80V probably benign Het
Pcsk1 T A 13: 75,238,210 (GRCm39) C10* probably null Het
Pdlim5 A T 3: 142,017,948 (GRCm39) S107T probably benign Het
Plac8l1 T A 18: 42,313,445 (GRCm39) D99V probably damaging Het
Plin2 A T 4: 86,575,349 (GRCm39) V400E probably damaging Het
Plxna1 G A 6: 89,334,102 (GRCm39) P176S probably benign Het
Pnn A G 12: 59,117,223 (GRCm39) K238R probably damaging Het
Pou5f1 A G 17: 35,820,933 (GRCm39) E231G probably benign Het
Ppara A T 15: 85,682,077 (GRCm39) M258L probably benign Het
Prune2 G A 19: 17,097,882 (GRCm39) D1129N probably damaging Het
Rai14 G A 15: 10,633,249 (GRCm39) T47M probably damaging Het
Rdh5 T C 10: 128,753,969 (GRCm39) I117V probably benign Het
Rpain G A 11: 70,864,724 (GRCm39) C137Y probably damaging Het
Scn3a A G 2: 65,361,154 (GRCm39) V126A possibly damaging Het
Senp7 G T 16: 55,932,089 (GRCm39) L129F probably damaging Het
Setd1a A G 7: 127,390,399 (GRCm39) D1025G unknown Het
Sirt4 A T 5: 115,621,082 (GRCm39) V30E probably damaging Het
Slit1 C A 19: 41,715,512 (GRCm39) R113L probably damaging Het
Stxbp5l G A 16: 37,028,416 (GRCm39) T549I noncoding transcript Het
Sytl2 A G 7: 90,058,678 (GRCm39) M926V probably damaging Het
Tgfbr2 C T 9: 115,959,074 (GRCm39) W113* probably null Het
Tmem86a A G 7: 46,703,512 (GRCm39) Y213C probably damaging Het
Tpo T A 12: 30,154,045 (GRCm39) Y220F probably damaging Het
Ttc6 C A 12: 57,720,096 (GRCm39) A889E probably damaging Het
Tyw1 A G 5: 130,328,855 (GRCm39) D547G probably benign Het
Ubtfl1 A G 9: 18,320,523 (GRCm39) K17R probably benign Het
Usp46 T A 5: 74,163,354 (GRCm39) I331F probably benign Het
Vmn2r111 T C 17: 22,792,073 (GRCm39) H61R probably benign Het
Wdr75 T A 1: 45,861,706 (GRCm39) N715K probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Zfp772 A T 7: 7,207,096 (GRCm39) C198* probably null Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 93,879,496 (GRCm39) missense probably benign 0.01
IGL00975:Fgd6 APN 10 93,969,938 (GRCm39) missense probably damaging 0.98
IGL01366:Fgd6 APN 10 93,879,338 (GRCm39) missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 93,925,512 (GRCm39) splice site probably null
IGL01958:Fgd6 APN 10 93,974,170 (GRCm39) missense probably benign 0.25
IGL01988:Fgd6 APN 10 93,910,197 (GRCm39) splice site probably benign
IGL02019:Fgd6 APN 10 93,969,216 (GRCm39) missense probably damaging 1.00
IGL02074:Fgd6 APN 10 93,963,297 (GRCm39) missense probably damaging 1.00
IGL02227:Fgd6 APN 10 93,969,946 (GRCm39) missense probably damaging 1.00
IGL02262:Fgd6 APN 10 93,961,490 (GRCm39) missense probably damaging 0.98
IGL02353:Fgd6 APN 10 93,974,258 (GRCm39) missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 93,974,258 (GRCm39) missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 93,910,064 (GRCm39) missense probably benign 0.00
IGL02526:Fgd6 APN 10 93,936,373 (GRCm39) missense probably benign 0.21
IGL02607:Fgd6 APN 10 93,880,310 (GRCm39) missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 93,959,152 (GRCm39) missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 93,881,026 (GRCm39) missense probably damaging 1.00
IGL02884:Fgd6 APN 10 93,881,501 (GRCm39) splice site probably benign
IGL02995:Fgd6 APN 10 93,881,342 (GRCm39) nonsense probably null
IGL03189:Fgd6 APN 10 93,880,318 (GRCm39) missense probably benign 0.26
IGL03258:Fgd6 APN 10 93,969,215 (GRCm39) missense probably benign 0.44
IGL03396:Fgd6 APN 10 93,880,318 (GRCm39) missense probably benign 0.26
FR4449:Fgd6 UTSW 10 93,880,182 (GRCm39) small deletion probably benign
R0257:Fgd6 UTSW 10 93,879,777 (GRCm39) missense probably benign 0.11
R0926:Fgd6 UTSW 10 93,970,909 (GRCm39) missense probably benign 0.40
R1325:Fgd6 UTSW 10 93,963,289 (GRCm39) missense probably damaging 1.00
R1422:Fgd6 UTSW 10 93,881,234 (GRCm39) missense probably damaging 1.00
R1491:Fgd6 UTSW 10 93,880,694 (GRCm39) missense probably benign 0.06
R1593:Fgd6 UTSW 10 93,880,894 (GRCm39) missense probably damaging 1.00
R1624:Fgd6 UTSW 10 93,973,298 (GRCm39) missense probably benign 0.19
R1929:Fgd6 UTSW 10 93,880,868 (GRCm39) missense probably benign 0.01
R2064:Fgd6 UTSW 10 93,880,903 (GRCm39) missense probably damaging 0.98
R2965:Fgd6 UTSW 10 93,880,056 (GRCm39) missense probably benign 0.03
R2966:Fgd6 UTSW 10 93,880,056 (GRCm39) missense probably benign 0.03
R3889:Fgd6 UTSW 10 93,925,499 (GRCm39) missense probably damaging 1.00
R4094:Fgd6 UTSW 10 93,879,296 (GRCm39) missense probably damaging 1.00
R4605:Fgd6 UTSW 10 93,880,217 (GRCm39) missense probably benign 0.12
R4883:Fgd6 UTSW 10 93,975,715 (GRCm39) missense probably benign 0.00
R5217:Fgd6 UTSW 10 93,969,939 (GRCm39) missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 93,880,538 (GRCm39) missense probably benign 0.00
R5606:Fgd6 UTSW 10 93,974,190 (GRCm39) nonsense probably null
R5644:Fgd6 UTSW 10 93,969,912 (GRCm39) missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 93,973,427 (GRCm39) critical splice donor site probably null
R6258:Fgd6 UTSW 10 93,880,161 (GRCm39) missense probably benign 0.00
R6735:Fgd6 UTSW 10 93,910,182 (GRCm39) missense possibly damaging 0.94
R7181:Fgd6 UTSW 10 93,879,373 (GRCm39) missense probably benign 0.02
R7210:Fgd6 UTSW 10 93,969,954 (GRCm39) missense probably damaging 0.98
R7296:Fgd6 UTSW 10 93,975,743 (GRCm39) missense probably benign 0.02
R7296:Fgd6 UTSW 10 93,879,909 (GRCm39) nonsense probably null
R7697:Fgd6 UTSW 10 93,881,306 (GRCm39) missense probably damaging 0.99
R7747:Fgd6 UTSW 10 93,880,778 (GRCm39) missense probably damaging 1.00
R7861:Fgd6 UTSW 10 93,939,193 (GRCm39) missense probably benign 0.15
R7940:Fgd6 UTSW 10 93,956,344 (GRCm39) missense probably benign 0.02
R8022:Fgd6 UTSW 10 93,880,206 (GRCm39) missense possibly damaging 0.54
R8138:Fgd6 UTSW 10 93,970,005 (GRCm39) missense probably null 0.45
R8189:Fgd6 UTSW 10 93,910,077 (GRCm39) missense probably benign 0.00
R8213:Fgd6 UTSW 10 93,879,914 (GRCm39) missense probably benign 0.37
R8960:Fgd6 UTSW 10 93,880,868 (GRCm39) missense probably benign 0.06
R8981:Fgd6 UTSW 10 93,880,916 (GRCm39) missense possibly damaging 0.80
R8989:Fgd6 UTSW 10 93,959,425 (GRCm39) missense probably damaging 0.97
R9609:Fgd6 UTSW 10 93,879,674 (GRCm39) missense probably damaging 0.99
RF031:Fgd6 UTSW 10 93,880,187 (GRCm39) frame shift probably null
RF040:Fgd6 UTSW 10 93,880,187 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTCACATGGCCAGGATGAG -3'
(R):5'- GGAACAAACTTAAGCCTTTGCAGC -3'

Sequencing Primer
(F):5'- CAGGATGAGGGACCTGGTTC -3'
(R):5'- AAACTTAAGCCTTTGCAGCCTCTC -3'
Posted On 2020-07-13