Mutagenetix > Incidental Mutation

Incidental Mutation 'R8171:Tpo'

634139

Institutional Source

Beutler Lab

Gene Symbol

Tpo

Ensembl Gene

ENSMUSG00000020673

Gene Name

thyroid peroxidase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R8171 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30054659-30132624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30104046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 220 (Y220F)

Ref Sequence

ENSEMBL: ENSMUSP00000021005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021005]

AlphaFold

P35419

Predicted Effect

probably damaging
Transcript: ENSMUST00000021005
AA Change: Y220F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021005
Gene: ENSMUSG00000020673
AA Change: Y220F

Domain	Start	End	E-Value	Type
transmembrane domain	5	24	N/A	INTRINSIC
Pfam:An_peroxidase	145	697	4.2e-180	PFAM
CCP	730	782	1.26e-7	SMART
EGF_CA	784	827	3.51e-10	SMART
transmembrane domain	837	859	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a membrane-bound glycoprotein. The encoded enzyme plays a central role in thyroid gland function. The enzyme functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mice with homozygous missense mutations in this gene exhibit hypothyroid dwarfism and hearing impairment. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mice with a missense mutation exhibit hypothyroid dwarfism, including a goiter with colloid deficiency and abnormal follicle epithelium, reduced hematocrit and red blood cells and a lifespan of about 3 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	G	T	14: 32,662,025	A661E	probably benign	Het
4932438A13Rik	T	C	3: 36,975,713	V2423A	probably benign	Het
4933425L06Rik	T	A	13: 105,109,783	V284E	probably benign	Het
Abhd14a	T	A	9: 106,440,761	T142S	probably benign	Het
Actn1	A	G	12: 80,196,393		probably null	Het
Adss	T	C	1: 177,796,351	N15S	probably benign	Het
Alpk2	A	G	18: 65,305,983	S780P	probably benign	Het
Asap1	G	T	15: 64,110,966	L830M	probably damaging	Het
Atic	T	C	1: 71,569,873	V319A	possibly damaging	Het
Atp8a2	A	T	14: 60,046,044	I87N	probably damaging	Het
Bace2	G	T	16: 97,424,586	V407L	possibly damaging	Het
Bmp3	A	T	5: 98,872,669	Y317F	probably damaging	Het
Ccdc159	A	G	9: 21,933,711	E291G	possibly damaging	Het
Cct8l1	T	A	5: 25,516,554	L89Q	probably damaging	Het
Cep83	T	A	10: 94,768,935	N503K	possibly damaging	Het
Ces4a	A	G	8: 105,147,207	Y436C	probably damaging	Het
Cftr	T	A	6: 18,258,288	D579E	probably damaging	Het
Chd9	T	A	8: 91,025,387	V1751D	possibly damaging	Het
Clasp2	A	T	9: 113,903,906	T937S	possibly damaging	Het
Clock	T	A	5: 76,266,414	D17V	possibly damaging	Het
Cpm	T	C	10: 117,683,315	L376P	probably damaging	Het
Crocc2	T	C	1: 93,189,001		probably null	Het
Csnk1g2	A	G	10: 80,639,802	D401G	probably damaging	Het
Cyb5r4	C	T	9: 87,042,810	L206F	possibly damaging	Het
Cyp1a1	T	A	9: 57,700,196	W36R	probably benign	Het
Cyp3a59	A	T	5: 146,085,774	H30L	probably damaging	Het
Dab2	G	A	15: 6,423,926	V182I	probably benign	Het
Dnah1	G	T	14: 31,297,110	F1342L	probably damaging	Het
Draxin	A	T	4: 148,115,666	L109Q	possibly damaging	Het
Elfn1	G	A	5: 139,971,357	V39M	probably damaging	Het
Erlin1	A	G	19: 44,069,329	I19T	probably benign	Het
F830016B08Rik	T	A	18: 60,300,078	S78T	possibly damaging	Het
Fer1l4	A	G	2: 156,048,231	V258A	probably benign	Het
Fgb	T	C	3: 83,042,515	D445G	probably damaging	Het
Fgd6	T	C	10: 94,074,332		probably null	Het
Frem3	T	A	8: 80,615,240	D1387E	probably damaging	Het
Gdf3	T	C	6: 122,609,903	T22A	probably benign	Het
Glcci1	C	T	6: 8,593,167	A511V	probably benign	Het
Gldc	A	T	19: 30,133,761	N538K	probably benign	Het
Glipr1l1	C	T	10: 112,078,384	P217S	probably benign	Het
Gm35339	C	A	15: 76,363,619	F1614L		Het
Gpr161	A	G	1: 165,306,436	N89S	probably damaging	Het
Gypa	T	A	8: 80,509,463	S166T	probably benign	Het
Hcar1	A	G	5: 123,879,089	S180P	probably damaging	Het
Hcn1	T	C	13: 117,602,734	S11P	unknown	Het
Hectd4	A	G	5: 121,318,756	E728G	possibly damaging	Het
Ints14	A	T	9: 64,973,250	H213L	possibly damaging	Het
Itih1	A	T	14: 30,937,090	M323K	possibly damaging	Het
Ivl	A	G	3: 92,571,778	S327P	probably damaging	Het
Kcnt2	T	A	1: 140,509,465	N545K	probably benign	Het
Kdm4b	A	T	17: 56,389,534	R417W	probably damaging	Het
Kif13a	T	C	13: 46,778,968	E1083G	probably damaging	Het
Klhl40	A	T	9: 121,778,557	H261L	probably benign	Het
Kpnb1	A	G	11: 97,175,747		probably null	Het
Lamc3	C	A	2: 31,914,971	T621N	probably benign	Het
Lingo3	T	C	10: 80,834,761	H445R	probably benign	Het
Ly75	G	A	2: 60,314,228	T1297I	possibly damaging	Het
Lypd6	C	T	2: 50,190,747	T149M	possibly damaging	Het
Mcrs1	A	T	15: 99,248,732	D139E	probably damaging	Het
Muc5b	G	A	7: 141,861,000	S2561N	unknown	Het
Mybpc1	C	T	10: 88,523,003	G1095R	probably damaging	Het
Myh1	A	G	11: 67,202,572	Y163C	probably damaging	Het
Notch4	T	A	17: 34,582,509	C1110*	probably null	Het
Olfr1257	A	G	2: 89,881,065	I80V	probably benign	Het
Olfr527	A	T	7: 140,336,230	I123F	probably damaging	Het
Olfr705	C	T	7: 106,714,618	S21N	probably benign	Het
Olfr705	T	A	7: 106,714,619	S21C		Het
Pcsk1	T	A	13: 75,090,091	C10*	probably null	Het
Pdlim5	A	T	3: 142,312,187	S107T	probably benign	Het
Plac8l1	T	A	18: 42,180,380	D99V	probably damaging	Het
Plin2	A	T	4: 86,657,112	V400E	probably damaging	Het
Plxna1	G	A	6: 89,357,120	P176S	probably benign	Het
Pnn	A	G	12: 59,070,437	K238R	probably damaging	Het
Pou5f1	A	G	17: 35,510,036	E231G	probably benign	Het
Ppara	A	T	15: 85,797,876	M258L	probably benign	Het
Prune2	G	A	19: 17,120,518	D1129N	probably damaging	Het
Rai14	G	A	15: 10,633,163	T47M	probably damaging	Het
Rdh5	T	C	10: 128,918,100	I117V	probably benign	Het
Rpain	G	A	11: 70,973,898	C137Y	probably damaging	Het
Scn3a	A	G	2: 65,530,810	V126A	possibly damaging	Het
Senp7	G	T	16: 56,111,726	L129F	probably damaging	Het
Setd1a	A	G	7: 127,791,227	D1025G	unknown	Het
Sirt4	A	T	5: 115,483,023	V30E	probably damaging	Het
Slit1	C	A	19: 41,727,073	R113L	probably damaging	Het
Stxbp5l	G	A	16: 37,208,054	T549I	noncoding transcript	Het
Sytl2	A	G	7: 90,409,470	M926V	probably damaging	Het
Tgfbr2	C	T	9: 116,130,006	W113*	probably null	Het
Tmem86a	A	G	7: 47,053,764	Y213C	probably damaging	Het
Ttc6	C	A	12: 57,673,310	A889E	probably damaging	Het
Tyw1	A	G	5: 130,300,014	D547G	probably benign	Het
Ubtfl1	A	G	9: 18,409,227	K17R	probably benign	Het
Usp46	T	A	5: 74,002,693	I331F	probably benign	Het
Vmn2r111	T	C	17: 22,573,092	H61R	probably benign	Het
Wdr75	T	A	1: 45,822,546	N715K	probably benign	Het
Zfp772	A	T	7: 7,204,097	C198*	probably null	Het

Other mutations in Tpo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Tpo	APN	12	30084620	missense	probably damaging	1.00
IGL00694:Tpo	APN	12	30105994	missense	probably damaging	0.98
IGL01660:Tpo	APN	12	30119400	splice site	probably benign
IGL01939:Tpo	APN	12	30084647	missense	possibly damaging	0.83
IGL02624:Tpo	APN	12	30100414	missense	probably benign	0.40
IGL03268:Tpo	APN	12	30094965	missense	possibly damaging	0.82
IGL03330:Tpo	APN	12	30103501	missense	probably damaging	0.97
IGL03138:Tpo	UTSW	12	30074171	missense	probably benign	0.00
R0025:Tpo	UTSW	12	30100390	missense	probably benign	0.03
R0025:Tpo	UTSW	12	30100390	missense	probably benign	0.03
R0076:Tpo	UTSW	12	30104023	missense	probably damaging	1.00
R0472:Tpo	UTSW	12	30100486	missense	probably benign	0.03
R1389:Tpo	UTSW	12	30103110	missense	probably damaging	0.98
R1493:Tpo	UTSW	12	30131809	missense	possibly damaging	0.78
R1526:Tpo	UTSW	12	30084695	missense	probably damaging	0.99
R1674:Tpo	UTSW	12	30100568	missense	probably benign	0.16
R1689:Tpo	UTSW	12	30098246	missense	probably damaging	1.00
R1986:Tpo	UTSW	12	30119466	missense	probably damaging	1.00
R2381:Tpo	UTSW	12	30131827	missense	possibly damaging	0.67
R2484:Tpo	UTSW	12	30103969	missense	probably benign	0.12
R2902:Tpo	UTSW	12	30119449	missense	possibly damaging	0.91
R4105:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4106:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4107:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4108:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4109:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4374:Tpo	UTSW	12	30103152	missense	possibly damaging	0.50
R4425:Tpo	UTSW	12	30104016	missense	probably damaging	1.00
R4600:Tpo	UTSW	12	30098229	missense	probably benign	0.32
R4668:Tpo	UTSW	12	30103290	missense	probably benign	0.03
R4758:Tpo	UTSW	12	30075871	missense	probably damaging	1.00
R4838:Tpo	UTSW	12	30092634	missense	probably damaging	1.00
R4869:Tpo	UTSW	12	30103365	missense	probably benign	0.00
R5163:Tpo	UTSW	12	30105980	missense	probably benign	0.00
R5223:Tpo	UTSW	12	30092590	missense	probably damaging	0.99
R5367:Tpo	UTSW	12	30103290	missense	probably damaging	1.00
R5658:Tpo	UTSW	12	30055138	missense	possibly damaging	0.95
R5660:Tpo	UTSW	12	30100496	missense	possibly damaging	0.92
R5671:Tpo	UTSW	12	30119491	missense	probably benign	0.00
R6019:Tpo	UTSW	12	30094981	missense	possibly damaging	0.94
R6074:Tpo	UTSW	12	30078187	missense	probably benign	0.15
R6181:Tpo	UTSW	12	30131885	missense	probably benign	0.37
R6321:Tpo	UTSW	12	30103108	missense	probably damaging	1.00
R6433:Tpo	UTSW	12	30084754	missense	probably benign
R7206:Tpo	UTSW	12	30103134	missense	possibly damaging	0.76
R7234:Tpo	UTSW	12	30092686	missense	probably benign	0.00
R7473:Tpo	UTSW	12	30092590	missense	probably benign	0.15
R7571:Tpo	UTSW	12	30119432	missense	probably benign	0.00
R7709:Tpo	UTSW	12	30131860	missense	possibly damaging	0.62
R7844:Tpo	UTSW	12	30100405	missense	probably damaging	1.00
R7859:Tpo	UTSW	12	30100574	missense	probably damaging	1.00
R7883:Tpo	UTSW	12	30103170	missense	probably damaging	1.00
R8138:Tpo	UTSW	12	30074104	missense	probably benign	0.00
R8726:Tpo	UTSW	12	30055138	missense	possibly damaging	0.95
R8877:Tpo	UTSW	12	30092739	missense	probably damaging	0.99
R9400:Tpo	UTSW	12	30119442	missense	possibly damaging	0.94
R9649:Tpo	UTSW	12	30075876	missense	probably damaging	1.00
X0050:Tpo	UTSW	12	30078094	missense	probably damaging	1.00
Z1088:Tpo	UTSW	12	30094782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAGAAAGCTCCTGGGGATG -3'
(R):5'- TCAGAGCCGTGAACAAGAGC -3'

Sequencing Primer
(F):5'- AGGAGACTTTGCATTTATGTTAAGC -3'
(R):5'- GAGCCTCACCATGAATTTAAGAC -3'

Posted On

2020-07-13