Incidental Mutation 'R8171:3425401B19Rik'
ID 634149
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene Name RIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 067597-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8171 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 32381076-32407250 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32383982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 661 (A661E)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
AlphaFold D3Z1D3
Predicted Effect probably benign
Transcript: ENSMUST00000096038
AA Change: A661E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: A661E

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14a T A 9: 106,317,960 (GRCm39) T142S probably benign Het
Actn1 A G 12: 80,243,167 (GRCm39) probably null Het
Adss2 T C 1: 177,623,917 (GRCm39) N15S probably benign Het
Alpk2 A G 18: 65,439,054 (GRCm39) S780P probably benign Het
Asap1 G T 15: 63,982,815 (GRCm39) L830M probably damaging Het
Atic T C 1: 71,609,032 (GRCm39) V319A possibly damaging Het
Atp8a2 A T 14: 60,283,493 (GRCm39) I87N probably damaging Het
Bace2 G T 16: 97,225,786 (GRCm39) V407L possibly damaging Het
Bltp1 T C 3: 37,029,862 (GRCm39) V2423A probably benign Het
Bmp3 A T 5: 99,020,528 (GRCm39) Y317F probably damaging Het
Ccdc159 A G 9: 21,845,007 (GRCm39) E291G possibly damaging Het
Cct8l1 T A 5: 25,721,552 (GRCm39) L89Q probably damaging Het
Cep83 T A 10: 94,604,797 (GRCm39) N503K possibly damaging Het
Ces4a A G 8: 105,873,839 (GRCm39) Y436C probably damaging Het
Cftr T A 6: 18,258,287 (GRCm39) D579E probably damaging Het
Chd9 T A 8: 91,752,015 (GRCm39) V1751D possibly damaging Het
Clasp2 A T 9: 113,732,974 (GRCm39) T937S possibly damaging Het
Clock T A 5: 76,414,261 (GRCm39) D17V possibly damaging Het
Cpm T C 10: 117,519,220 (GRCm39) L376P probably damaging Het
Crocc2 T C 1: 93,116,723 (GRCm39) probably null Het
Csnk1g2 A G 10: 80,475,636 (GRCm39) D401G probably damaging Het
Cyb5r4 C T 9: 86,924,863 (GRCm39) L206F possibly damaging Het
Cyp1a1 T A 9: 57,607,479 (GRCm39) W36R probably benign Het
Cyp3a59 A T 5: 146,022,584 (GRCm39) H30L probably damaging Het
Dab2 G A 15: 6,453,407 (GRCm39) V182I probably benign Het
Dnah1 G T 14: 31,019,067 (GRCm39) F1342L probably damaging Het
Draxin A T 4: 148,200,123 (GRCm39) L109Q possibly damaging Het
Elfn1 G A 5: 139,957,112 (GRCm39) V39M probably damaging Het
Erlin1 A G 19: 44,057,768 (GRCm39) I19T probably benign Het
F830016B08Rik T A 18: 60,433,150 (GRCm39) S78T possibly damaging Het
Fer1l4 A G 2: 155,890,151 (GRCm39) V258A probably benign Het
Fgb T C 3: 82,949,822 (GRCm39) D445G probably damaging Het
Fgd6 T C 10: 93,910,194 (GRCm39) probably null Het
Frem3 T A 8: 81,341,869 (GRCm39) D1387E probably damaging Het
Gdf3 T C 6: 122,586,862 (GRCm39) T22A probably benign Het
Glcci1 C T 6: 8,593,167 (GRCm39) A511V probably benign Het
Gldc A T 19: 30,111,161 (GRCm39) N538K probably benign Het
Glipr1l1 C T 10: 111,914,289 (GRCm39) P217S probably benign Het
Gpr161 A G 1: 165,134,005 (GRCm39) N89S probably damaging Het
Gypa T A 8: 81,236,092 (GRCm39) S166T probably benign Het
Hcar1 A G 5: 124,017,152 (GRCm39) S180P probably damaging Het
Hcn1 T C 13: 117,739,270 (GRCm39) S11P unknown Het
Hectd4 A G 5: 121,456,819 (GRCm39) E728G possibly damaging Het
Ints14 A T 9: 64,880,532 (GRCm39) H213L possibly damaging Het
Itih1 A T 14: 30,659,047 (GRCm39) M323K possibly damaging Het
Ivl A G 3: 92,479,085 (GRCm39) S327P probably damaging Het
Kcnt2 T A 1: 140,437,203 (GRCm39) N545K probably benign Het
Kdm4b A T 17: 56,696,534 (GRCm39) R417W probably damaging Het
Kif13a T C 13: 46,932,444 (GRCm39) E1083G probably damaging Het
Klhl40 A T 9: 121,607,623 (GRCm39) H261L probably benign Het
Kpnb1 A G 11: 97,066,573 (GRCm39) probably null Het
Lamc3 C A 2: 31,804,983 (GRCm39) T621N probably benign Het
Lingo3 T C 10: 80,670,595 (GRCm39) H445R probably benign Het
Ly75 G A 2: 60,144,572 (GRCm39) T1297I possibly damaging Het
Lypd6 C T 2: 50,080,759 (GRCm39) T149M possibly damaging Het
Mcrs1 A T 15: 99,146,613 (GRCm39) D139E probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Mybpc1 C T 10: 88,358,865 (GRCm39) G1095R probably damaging Het
Myh1 A G 11: 67,093,398 (GRCm39) Y163C probably damaging Het
Notch4 T A 17: 34,801,483 (GRCm39) C1110* probably null Het
Nt5el T A 13: 105,246,291 (GRCm39) V284E probably benign Het
Or12j2 A T 7: 139,916,143 (GRCm39) I123F probably damaging Het
Or2ag1 C T 7: 106,313,825 (GRCm39) S21N probably benign Het
Or2ag1 T A 7: 106,313,826 (GRCm39) S21C Het
Or4c10b A G 2: 89,711,409 (GRCm39) I80V probably benign Het
Pcsk1 T A 13: 75,238,210 (GRCm39) C10* probably null Het
Pdlim5 A T 3: 142,017,948 (GRCm39) S107T probably benign Het
Plac8l1 T A 18: 42,313,445 (GRCm39) D99V probably damaging Het
Plin2 A T 4: 86,575,349 (GRCm39) V400E probably damaging Het
Plxna1 G A 6: 89,334,102 (GRCm39) P176S probably benign Het
Pnn A G 12: 59,117,223 (GRCm39) K238R probably damaging Het
Pou5f1 A G 17: 35,820,933 (GRCm39) E231G probably benign Het
Ppara A T 15: 85,682,077 (GRCm39) M258L probably benign Het
Prune2 G A 19: 17,097,882 (GRCm39) D1129N probably damaging Het
Rai14 G A 15: 10,633,249 (GRCm39) T47M probably damaging Het
Rdh5 T C 10: 128,753,969 (GRCm39) I117V probably benign Het
Rpain G A 11: 70,864,724 (GRCm39) C137Y probably damaging Het
Scn3a A G 2: 65,361,154 (GRCm39) V126A possibly damaging Het
Senp7 G T 16: 55,932,089 (GRCm39) L129F probably damaging Het
Setd1a A G 7: 127,390,399 (GRCm39) D1025G unknown Het
Sirt4 A T 5: 115,621,082 (GRCm39) V30E probably damaging Het
Slit1 C A 19: 41,715,512 (GRCm39) R113L probably damaging Het
Stxbp5l G A 16: 37,028,416 (GRCm39) T549I noncoding transcript Het
Sytl2 A G 7: 90,058,678 (GRCm39) M926V probably damaging Het
Tgfbr2 C T 9: 115,959,074 (GRCm39) W113* probably null Het
Tmem86a A G 7: 46,703,512 (GRCm39) Y213C probably damaging Het
Tpo T A 12: 30,154,045 (GRCm39) Y220F probably damaging Het
Ttc6 C A 12: 57,720,096 (GRCm39) A889E probably damaging Het
Tyw1 A G 5: 130,328,855 (GRCm39) D547G probably benign Het
Ubtfl1 A G 9: 18,320,523 (GRCm39) K17R probably benign Het
Usp46 T A 5: 74,163,354 (GRCm39) I331F probably benign Het
Vmn2r111 T C 17: 22,792,073 (GRCm39) H61R probably benign Het
Wdr75 T A 1: 45,861,706 (GRCm39) N715K probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Zfp772 A T 7: 7,207,096 (GRCm39) C198* probably null Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32,382,873 (GRCm39) missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32,384,956 (GRCm39) nonsense probably null
IGL01292:3425401B19Rik APN 14 32,382,831 (GRCm39) missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32,383,893 (GRCm39) missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32,382,908 (GRCm39) missense probably benign
IGL01470:3425401B19Rik APN 14 32,382,414 (GRCm39) missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32,381,988 (GRCm39) missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32,381,762 (GRCm39) missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32,383,583 (GRCm39) missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32,384,672 (GRCm39) missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32,384,418 (GRCm39) missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32,381,772 (GRCm39) missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32,383,190 (GRCm39) missense probably benign
IGL03401:3425401B19Rik APN 14 32,384,223 (GRCm39) nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32,383,068 (GRCm39) nonsense probably null
R0233:3425401B19Rik UTSW 14 32,385,330 (GRCm39) missense probably benign
R0233:3425401B19Rik UTSW 14 32,385,330 (GRCm39) missense probably benign
R0320:3425401B19Rik UTSW 14 32,384,571 (GRCm39) missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32,384,919 (GRCm39) missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32,384,598 (GRCm39) missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32,384,454 (GRCm39) missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32,384,228 (GRCm39) missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32,384,039 (GRCm39) missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32,382,771 (GRCm39) missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32,382,005 (GRCm39) missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32,384,508 (GRCm39) missense probably benign
R2212:3425401B19Rik UTSW 14 32,383,559 (GRCm39) missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32,385,791 (GRCm39) missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32,385,449 (GRCm39) missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32,383,809 (GRCm39) missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32,383,559 (GRCm39) missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32,385,025 (GRCm39) missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32,385,650 (GRCm39) missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32,382,912 (GRCm39) missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32,383,828 (GRCm39) missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32,385,107 (GRCm39) missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32,382,174 (GRCm39) missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32,384,588 (GRCm39) missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32,385,245 (GRCm39) missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32,385,137 (GRCm39) missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32,383,361 (GRCm39) missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32,383,749 (GRCm39) missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32,383,749 (GRCm39) missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32,383,749 (GRCm39) missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32,385,266 (GRCm39) missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32,383,413 (GRCm39) missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32,384,993 (GRCm39) missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32,384,010 (GRCm39) missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32,384,010 (GRCm39) missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32,382,309 (GRCm39) missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32,383,632 (GRCm39) nonsense probably null
R5940:3425401B19Rik UTSW 14 32,384,645 (GRCm39) missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32,382,614 (GRCm39) missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32,384,239 (GRCm39) missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32,385,651 (GRCm39) missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32,383,236 (GRCm39) missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32,384,645 (GRCm39) missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32,383,937 (GRCm39) missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32,382,131 (GRCm39) missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32,385,271 (GRCm39) missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32,385,257 (GRCm39) missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32,384,589 (GRCm39) missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32,384,714 (GRCm39) missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32,385,026 (GRCm39) missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32,381,797 (GRCm39) missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32,384,618 (GRCm39) missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32,382,266 (GRCm39) nonsense probably null
R8276:3425401B19Rik UTSW 14 32,385,885 (GRCm39) missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32,381,750 (GRCm39) missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32,384,254 (GRCm39) missense possibly damaging 0.84
R8464:3425401B19Rik UTSW 14 32,381,934 (GRCm39) missense possibly damaging 0.53
R8880:3425401B19Rik UTSW 14 32,382,837 (GRCm39) missense probably benign 0.33
R8898:3425401B19Rik UTSW 14 32,383,001 (GRCm39) nonsense probably null
R8911:3425401B19Rik UTSW 14 32,383,626 (GRCm39) missense possibly damaging 0.53
R8934:3425401B19Rik UTSW 14 32,382,614 (GRCm39) missense possibly damaging 0.53
R9094:3425401B19Rik UTSW 14 32,382,614 (GRCm39) missense possibly damaging 0.53
R9399:3425401B19Rik UTSW 14 32,384,615 (GRCm39) missense probably damaging 0.98
R9435:3425401B19Rik UTSW 14 32,382,562 (GRCm39) missense probably benign 0.08
R9485:3425401B19Rik UTSW 14 32,383,400 (GRCm39) missense possibly damaging 0.85
R9766:3425401B19Rik UTSW 14 32,385,788 (GRCm39) missense probably benign 0.00
X0025:3425401B19Rik UTSW 14 32,384,426 (GRCm39) missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32,383,355 (GRCm39) missense probably damaging 0.99
Z1177:3425401B19Rik UTSW 14 32,381,765 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGGAGTAAAATCAGACTGGCTG -3'
(R):5'- ATCCTTTGCAGTCAGCCACC -3'

Sequencing Primer
(F):5'- TGGCTGTCGCTGTAAAACAC -3'
(R):5'- AAACCCACTTCTGTGTCAATGGG -3'
Posted On 2020-07-13