Incidental Mutation 'R8171:3425401B19Rik'
ID634149
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8171 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32662025 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 661 (A661E)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably benign
Transcript: ENSMUST00000096038
AA Change: A661E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: A661E

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,975,713 V2423A probably benign Het
4933425L06Rik T A 13: 105,109,783 V284E probably benign Het
Abhd14a T A 9: 106,440,761 T142S probably benign Het
Actn1 A G 12: 80,196,393 probably null Het
Adss T C 1: 177,796,351 N15S probably benign Het
Alpk2 A G 18: 65,305,983 S780P probably benign Het
Asap1 G T 15: 64,110,966 L830M probably damaging Het
Atic T C 1: 71,569,873 V319A possibly damaging Het
Atp8a2 A T 14: 60,046,044 I87N probably damaging Het
Bace2 G T 16: 97,424,586 V407L possibly damaging Het
Bmp3 A T 5: 98,872,669 Y317F probably damaging Het
Ccdc159 A G 9: 21,933,711 E291G possibly damaging Het
Cct8l1 T A 5: 25,516,554 L89Q probably damaging Het
Cep83 T A 10: 94,768,935 N503K possibly damaging Het
Ces4a A G 8: 105,147,207 Y436C probably damaging Het
Cftr T A 6: 18,258,288 D579E probably damaging Het
Chd9 T A 8: 91,025,387 V1751D possibly damaging Het
Clasp2 A T 9: 113,903,906 T937S possibly damaging Het
Clock T A 5: 76,266,414 D17V possibly damaging Het
Cpm T C 10: 117,683,315 L376P probably damaging Het
Crocc2 T C 1: 93,189,001 probably null Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Cyb5r4 C T 9: 87,042,810 L206F possibly damaging Het
Cyp1a1 T A 9: 57,700,196 W36R probably benign Het
Cyp3a59 A T 5: 146,085,774 H30L probably damaging Het
Dab2 G A 15: 6,423,926 V182I probably benign Het
Dnah1 G T 14: 31,297,110 F1342L probably damaging Het
Draxin A T 4: 148,115,666 L109Q possibly damaging Het
Elfn1 G A 5: 139,971,357 V39M probably damaging Het
Erlin1 A G 19: 44,069,329 I19T probably benign Het
F830016B08Rik T A 18: 60,300,078 S78T possibly damaging Het
Fer1l4 A G 2: 156,048,231 V258A probably benign Het
Fgb T C 3: 83,042,515 D445G probably damaging Het
Fgd6 T C 10: 94,074,332 probably null Het
Frem3 T A 8: 80,615,240 D1387E probably damaging Het
Gdf3 T C 6: 122,609,903 T22A probably benign Het
Glcci1 C T 6: 8,593,167 A511V probably benign Het
Gldc A T 19: 30,133,761 N538K probably benign Het
Glipr1l1 C T 10: 112,078,384 P217S probably benign Het
Gm15800 A G 5: 121,318,756 E728G possibly damaging Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr161 A G 1: 165,306,436 N89S probably damaging Het
Gypa T A 8: 80,509,463 S166T probably benign Het
Hcar1 A G 5: 123,879,089 S180P probably damaging Het
Hcn1 T C 13: 117,602,734 S11P unknown Het
Itih1 A T 14: 30,937,090 M323K possibly damaging Het
Ivl A G 3: 92,571,778 S327P probably damaging Het
Kcnt2 T A 1: 140,509,465 N545K probably benign Het
Kdm4b A T 17: 56,389,534 R417W probably damaging Het
Kif13a T C 13: 46,778,968 E1083G probably damaging Het
Klhl40 A T 9: 121,778,557 H261L probably benign Het
Kpnb1 A G 11: 97,175,747 probably null Het
Lamc3 C A 2: 31,914,971 T621N probably benign Het
Lingo3 T C 10: 80,834,761 H445R probably benign Het
Ly75 G A 2: 60,314,228 T1297I possibly damaging Het
Lypd6 C T 2: 50,190,747 T149M possibly damaging Het
Mcrs1 A T 15: 99,248,732 D139E probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Mybpc1 C T 10: 88,523,003 G1095R probably damaging Het
Myh1 A G 11: 67,202,572 Y163C probably damaging Het
Notch4 T A 17: 34,582,509 C1110* probably null Het
Olfr1257 A G 2: 89,881,065 I80V probably benign Het
Olfr527 A T 7: 140,336,230 I123F probably damaging Het
Olfr705 T A 7: 106,714,619 S21C Het
Olfr705 C T 7: 106,714,618 S21N probably benign Het
Pcsk1 T A 13: 75,090,091 C10* probably null Het
Pdlim5 A T 3: 142,312,187 S107T probably benign Het
Plac8l1 T A 18: 42,180,380 D99V probably damaging Het
Plin2 A T 4: 86,657,112 V400E probably damaging Het
Plxna1 G A 6: 89,357,120 P176S probably benign Het
Pnn A G 12: 59,070,437 K238R probably damaging Het
Pou5f1 A G 17: 35,510,036 E231G probably benign Het
Ppara A T 15: 85,797,876 M258L probably benign Het
Prune2 G A 19: 17,120,518 D1129N probably damaging Het
Rai14 G A 15: 10,633,163 T47M probably damaging Het
Rdh5 T C 10: 128,918,100 I117V probably benign Het
Rpain G A 11: 70,973,898 C137Y probably damaging Het
Scn3a A G 2: 65,530,810 V126A possibly damaging Het
Senp7 G T 16: 56,111,726 L129F probably damaging Het
Setd1a A G 7: 127,791,227 D1025G unknown Het
Sirt4 A T 5: 115,483,023 V30E probably damaging Het
Slit1 C A 19: 41,727,073 R113L probably damaging Het
Stxbp5l G A 16: 37,208,054 T549I noncoding transcript Het
Sytl2 A G 7: 90,409,470 M926V probably damaging Het
Tgfbr2 C T 9: 116,130,006 W113* probably null Het
Tmem86a A G 7: 47,053,764 Y213C probably damaging Het
Tpo T A 12: 30,104,046 Y220F probably damaging Het
Ttc6 C A 12: 57,673,310 A889E probably damaging Het
Tyw1 A G 5: 130,300,014 D547G probably benign Het
Ubtfl1 A G 9: 18,409,227 K17R probably benign Het
Usp46 T A 5: 74,002,693 I331F probably benign Het
Vmn2r111 T C 17: 22,573,092 H61R probably benign Het
Vwa9 A T 9: 64,973,250 H213L possibly damaging Het
Wdr75 T A 1: 45,822,546 N715K probably benign Het
Zfp772 A T 7: 7,204,097 C198* probably null Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGAGTAAAATCAGACTGGCTG -3'
(R):5'- ATCCTTTGCAGTCAGCCACC -3'

Sequencing Primer
(F):5'- TGGCTGTCGCTGTAAAACAC -3'
(R):5'- AAACCCACTTCTGTGTCAATGGG -3'
Posted On2020-07-13