Incidental Mutation 'R8171:Notch4'
ID 634161
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Name notch 4
Synonyms Int3, Int-3, N4
MMRRC Submission 067597-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8171 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34783242-34807477 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 34801483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1110 (C1110*)
Ref Sequence ENSEMBL: ENSMUSP00000015612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]
AlphaFold P31695
Predicted Effect probably null
Transcript: ENSMUST00000015612
AA Change: C1110*
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: C1110*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151654
Predicted Effect probably benign
Transcript: ENSMUST00000151867
Predicted Effect probably benign
Transcript: ENSMUST00000173389
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,383,982 (GRCm39) A661E probably benign Het
Abhd14a T A 9: 106,317,960 (GRCm39) T142S probably benign Het
Actn1 A G 12: 80,243,167 (GRCm39) probably null Het
Adss2 T C 1: 177,623,917 (GRCm39) N15S probably benign Het
Alpk2 A G 18: 65,439,054 (GRCm39) S780P probably benign Het
Asap1 G T 15: 63,982,815 (GRCm39) L830M probably damaging Het
Atic T C 1: 71,609,032 (GRCm39) V319A possibly damaging Het
Atp8a2 A T 14: 60,283,493 (GRCm39) I87N probably damaging Het
Bace2 G T 16: 97,225,786 (GRCm39) V407L possibly damaging Het
Bltp1 T C 3: 37,029,862 (GRCm39) V2423A probably benign Het
Bmp3 A T 5: 99,020,528 (GRCm39) Y317F probably damaging Het
Ccdc159 A G 9: 21,845,007 (GRCm39) E291G possibly damaging Het
Cct8l1 T A 5: 25,721,552 (GRCm39) L89Q probably damaging Het
Cep83 T A 10: 94,604,797 (GRCm39) N503K possibly damaging Het
Ces4a A G 8: 105,873,839 (GRCm39) Y436C probably damaging Het
Cftr T A 6: 18,258,287 (GRCm39) D579E probably damaging Het
Chd9 T A 8: 91,752,015 (GRCm39) V1751D possibly damaging Het
Clasp2 A T 9: 113,732,974 (GRCm39) T937S possibly damaging Het
Clock T A 5: 76,414,261 (GRCm39) D17V possibly damaging Het
Cpm T C 10: 117,519,220 (GRCm39) L376P probably damaging Het
Crocc2 T C 1: 93,116,723 (GRCm39) probably null Het
Csnk1g2 A G 10: 80,475,636 (GRCm39) D401G probably damaging Het
Cyb5r4 C T 9: 86,924,863 (GRCm39) L206F possibly damaging Het
Cyp1a1 T A 9: 57,607,479 (GRCm39) W36R probably benign Het
Cyp3a59 A T 5: 146,022,584 (GRCm39) H30L probably damaging Het
Dab2 G A 15: 6,453,407 (GRCm39) V182I probably benign Het
Dnah1 G T 14: 31,019,067 (GRCm39) F1342L probably damaging Het
Draxin A T 4: 148,200,123 (GRCm39) L109Q possibly damaging Het
Elfn1 G A 5: 139,957,112 (GRCm39) V39M probably damaging Het
Erlin1 A G 19: 44,057,768 (GRCm39) I19T probably benign Het
F830016B08Rik T A 18: 60,433,150 (GRCm39) S78T possibly damaging Het
Fer1l4 A G 2: 155,890,151 (GRCm39) V258A probably benign Het
Fgb T C 3: 82,949,822 (GRCm39) D445G probably damaging Het
Fgd6 T C 10: 93,910,194 (GRCm39) probably null Het
Frem3 T A 8: 81,341,869 (GRCm39) D1387E probably damaging Het
Gdf3 T C 6: 122,586,862 (GRCm39) T22A probably benign Het
Glcci1 C T 6: 8,593,167 (GRCm39) A511V probably benign Het
Gldc A T 19: 30,111,161 (GRCm39) N538K probably benign Het
Glipr1l1 C T 10: 111,914,289 (GRCm39) P217S probably benign Het
Gpr161 A G 1: 165,134,005 (GRCm39) N89S probably damaging Het
Gypa T A 8: 81,236,092 (GRCm39) S166T probably benign Het
Hcar1 A G 5: 124,017,152 (GRCm39) S180P probably damaging Het
Hcn1 T C 13: 117,739,270 (GRCm39) S11P unknown Het
Hectd4 A G 5: 121,456,819 (GRCm39) E728G possibly damaging Het
Ints14 A T 9: 64,880,532 (GRCm39) H213L possibly damaging Het
Itih1 A T 14: 30,659,047 (GRCm39) M323K possibly damaging Het
Ivl A G 3: 92,479,085 (GRCm39) S327P probably damaging Het
Kcnt2 T A 1: 140,437,203 (GRCm39) N545K probably benign Het
Kdm4b A T 17: 56,696,534 (GRCm39) R417W probably damaging Het
Kif13a T C 13: 46,932,444 (GRCm39) E1083G probably damaging Het
Klhl40 A T 9: 121,607,623 (GRCm39) H261L probably benign Het
Kpnb1 A G 11: 97,066,573 (GRCm39) probably null Het
Lamc3 C A 2: 31,804,983 (GRCm39) T621N probably benign Het
Lingo3 T C 10: 80,670,595 (GRCm39) H445R probably benign Het
Ly75 G A 2: 60,144,572 (GRCm39) T1297I possibly damaging Het
Lypd6 C T 2: 50,080,759 (GRCm39) T149M possibly damaging Het
Mcrs1 A T 15: 99,146,613 (GRCm39) D139E probably damaging Het
Muc5b G A 7: 141,414,737 (GRCm39) S2561N unknown Het
Mybpc1 C T 10: 88,358,865 (GRCm39) G1095R probably damaging Het
Myh1 A G 11: 67,093,398 (GRCm39) Y163C probably damaging Het
Nt5el T A 13: 105,246,291 (GRCm39) V284E probably benign Het
Or12j2 A T 7: 139,916,143 (GRCm39) I123F probably damaging Het
Or2ag1 C T 7: 106,313,825 (GRCm39) S21N probably benign Het
Or2ag1 T A 7: 106,313,826 (GRCm39) S21C Het
Or4c10b A G 2: 89,711,409 (GRCm39) I80V probably benign Het
Pcsk1 T A 13: 75,238,210 (GRCm39) C10* probably null Het
Pdlim5 A T 3: 142,017,948 (GRCm39) S107T probably benign Het
Plac8l1 T A 18: 42,313,445 (GRCm39) D99V probably damaging Het
Plin2 A T 4: 86,575,349 (GRCm39) V400E probably damaging Het
Plxna1 G A 6: 89,334,102 (GRCm39) P176S probably benign Het
Pnn A G 12: 59,117,223 (GRCm39) K238R probably damaging Het
Pou5f1 A G 17: 35,820,933 (GRCm39) E231G probably benign Het
Ppara A T 15: 85,682,077 (GRCm39) M258L probably benign Het
Prune2 G A 19: 17,097,882 (GRCm39) D1129N probably damaging Het
Rai14 G A 15: 10,633,249 (GRCm39) T47M probably damaging Het
Rdh5 T C 10: 128,753,969 (GRCm39) I117V probably benign Het
Rpain G A 11: 70,864,724 (GRCm39) C137Y probably damaging Het
Scn3a A G 2: 65,361,154 (GRCm39) V126A possibly damaging Het
Senp7 G T 16: 55,932,089 (GRCm39) L129F probably damaging Het
Setd1a A G 7: 127,390,399 (GRCm39) D1025G unknown Het
Sirt4 A T 5: 115,621,082 (GRCm39) V30E probably damaging Het
Slit1 C A 19: 41,715,512 (GRCm39) R113L probably damaging Het
Stxbp5l G A 16: 37,028,416 (GRCm39) T549I noncoding transcript Het
Sytl2 A G 7: 90,058,678 (GRCm39) M926V probably damaging Het
Tgfbr2 C T 9: 115,959,074 (GRCm39) W113* probably null Het
Tmem86a A G 7: 46,703,512 (GRCm39) Y213C probably damaging Het
Tpo T A 12: 30,154,045 (GRCm39) Y220F probably damaging Het
Ttc6 C A 12: 57,720,096 (GRCm39) A889E probably damaging Het
Tyw1 A G 5: 130,328,855 (GRCm39) D547G probably benign Het
Ubtfl1 A G 9: 18,320,523 (GRCm39) K17R probably benign Het
Usp46 T A 5: 74,163,354 (GRCm39) I331F probably benign Het
Vmn2r111 T C 17: 22,792,073 (GRCm39) H61R probably benign Het
Wdr75 T A 1: 45,861,706 (GRCm39) N715K probably benign Het
Wdr97 C A 15: 76,247,819 (GRCm39) F1614L Het
Zfp772 A T 7: 7,207,096 (GRCm39) C198* probably null Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34,794,535 (GRCm39) critical splice donor site probably null
IGL01022:Notch4 APN 17 34,784,671 (GRCm39) missense probably damaging 1.00
IGL01356:Notch4 APN 17 34,800,000 (GRCm39) missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34,791,562 (GRCm39) missense probably damaging 1.00
IGL02150:Notch4 APN 17 34,803,587 (GRCm39) missense probably damaging 1.00
IGL02248:Notch4 APN 17 34,806,172 (GRCm39) missense probably damaging 1.00
IGL02271:Notch4 APN 17 34,787,445 (GRCm39) missense probably damaging 1.00
IGL02299:Notch4 APN 17 34,796,978 (GRCm39) missense probably damaging 1.00
IGL02561:Notch4 APN 17 34,787,134 (GRCm39) splice site probably benign
IGL02604:Notch4 APN 17 34,784,362 (GRCm39) splice site probably null
IGL03323:Notch4 APN 17 34,801,445 (GRCm39) missense probably damaging 1.00
IGL03366:Notch4 APN 17 34,791,542 (GRCm39) missense probably damaging 1.00
IGL03408:Notch4 APN 17 34,784,542 (GRCm39) missense probably benign 0.03
K3955:Notch4 UTSW 17 34,787,436 (GRCm39) missense probably damaging 1.00
R0123:Notch4 UTSW 17 34,784,337 (GRCm39) missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34,800,473 (GRCm39) splice site probably benign
R0446:Notch4 UTSW 17 34,784,337 (GRCm39) missense possibly damaging 0.85
R0490:Notch4 UTSW 17 34,801,864 (GRCm39) missense probably damaging 1.00
R0504:Notch4 UTSW 17 34,794,065 (GRCm39) missense probably damaging 1.00
R0545:Notch4 UTSW 17 34,802,407 (GRCm39) missense probably damaging 1.00
R0702:Notch4 UTSW 17 34,794,177 (GRCm39) missense probably damaging 1.00
R0763:Notch4 UTSW 17 34,784,306 (GRCm39) nonsense probably null
R0854:Notch4 UTSW 17 34,787,546 (GRCm39) missense probably damaging 1.00
R1082:Notch4 UTSW 17 34,806,364 (GRCm39) missense probably damaging 1.00
R1196:Notch4 UTSW 17 34,787,837 (GRCm39) missense probably damaging 1.00
R1316:Notch4 UTSW 17 34,786,444 (GRCm39) missense probably damaging 1.00
R1493:Notch4 UTSW 17 34,786,656 (GRCm39) nonsense probably null
R1527:Notch4 UTSW 17 34,784,718 (GRCm39) missense probably damaging 1.00
R1548:Notch4 UTSW 17 34,787,396 (GRCm39) missense probably damaging 1.00
R1718:Notch4 UTSW 17 34,795,737 (GRCm39) splice site probably benign
R1855:Notch4 UTSW 17 34,799,936 (GRCm39) missense probably benign 0.05
R1988:Notch4 UTSW 17 34,806,562 (GRCm39) missense possibly damaging 0.59
R2022:Notch4 UTSW 17 34,806,502 (GRCm39) missense probably damaging 1.00
R2023:Notch4 UTSW 17 34,806,502 (GRCm39) missense probably damaging 1.00
R2078:Notch4 UTSW 17 34,787,689 (GRCm39) critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34,804,924 (GRCm39) missense probably benign 0.15
R3846:Notch4 UTSW 17 34,797,071 (GRCm39) missense probably damaging 1.00
R3874:Notch4 UTSW 17 34,797,043 (GRCm39) nonsense probably null
R4087:Notch4 UTSW 17 34,803,409 (GRCm39) missense probably damaging 1.00
R4456:Notch4 UTSW 17 34,802,807 (GRCm39) missense probably damaging 0.99
R4628:Notch4 UTSW 17 34,789,159 (GRCm39) missense probably damaging 1.00
R4728:Notch4 UTSW 17 34,789,179 (GRCm39) missense probably benign 0.00
R4778:Notch4 UTSW 17 34,801,485 (GRCm39) missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34,797,690 (GRCm39) splice site probably benign
R4828:Notch4 UTSW 17 34,789,034 (GRCm39) missense probably damaging 1.00
R4830:Notch4 UTSW 17 34,789,092 (GRCm39) missense probably damaging 1.00
R4859:Notch4 UTSW 17 34,806,154 (GRCm39) missense probably damaging 1.00
R4871:Notch4 UTSW 17 34,796,536 (GRCm39) missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34,799,894 (GRCm39) missense probably damaging 0.99
R5290:Notch4 UTSW 17 34,784,263 (GRCm39) missense probably benign 0.01
R5363:Notch4 UTSW 17 34,806,097 (GRCm39) missense probably damaging 1.00
R5860:Notch4 UTSW 17 34,801,392 (GRCm39) missense probably damaging 1.00
R6352:Notch4 UTSW 17 34,786,435 (GRCm39) missense probably damaging 1.00
R6385:Notch4 UTSW 17 34,792,788 (GRCm39) missense probably null 0.16
R6422:Notch4 UTSW 17 34,803,533 (GRCm39) missense probably benign
R6645:Notch4 UTSW 17 34,806,790 (GRCm39) missense probably benign 0.00
R6836:Notch4 UTSW 17 34,805,074 (GRCm39) missense probably damaging 0.96
R6943:Notch4 UTSW 17 34,802,577 (GRCm39) missense probably benign
R6991:Notch4 UTSW 17 34,803,774 (GRCm39) nonsense probably null
R7078:Notch4 UTSW 17 34,801,520 (GRCm39) missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34,791,667 (GRCm39) missense probably benign 0.05
R7182:Notch4 UTSW 17 34,802,473 (GRCm39) missense probably damaging 1.00
R7240:Notch4 UTSW 17 34,795,445 (GRCm39) missense probably benign 0.00
R7247:Notch4 UTSW 17 34,791,491 (GRCm39) missense probably damaging 1.00
R7556:Notch4 UTSW 17 34,794,444 (GRCm39) missense probably damaging 1.00
R7571:Notch4 UTSW 17 34,802,548 (GRCm39) missense probably damaging 0.99
R7697:Notch4 UTSW 17 34,789,159 (GRCm39) missense probably damaging 1.00
R7763:Notch4 UTSW 17 34,801,392 (GRCm39) missense probably damaging 1.00
R7994:Notch4 UTSW 17 34,797,064 (GRCm39) missense possibly damaging 0.82
R8139:Notch4 UTSW 17 34,803,774 (GRCm39) nonsense probably null
R8375:Notch4 UTSW 17 34,787,228 (GRCm39) missense possibly damaging 0.90
R8448:Notch4 UTSW 17 34,805,763 (GRCm39) splice site probably null
R8543:Notch4 UTSW 17 34,787,394 (GRCm39) missense probably damaging 1.00
R8776:Notch4 UTSW 17 34,806,579 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Notch4 UTSW 17 34,806,579 (GRCm39) missense probably damaging 1.00
R8847:Notch4 UTSW 17 34,803,962 (GRCm39) splice site probably benign
R8885:Notch4 UTSW 17 34,803,470 (GRCm39) missense possibly damaging 0.94
R9126:Notch4 UTSW 17 34,800,080 (GRCm39) missense probably benign 0.00
R9184:Notch4 UTSW 17 34,806,364 (GRCm39) missense probably damaging 1.00
R9425:Notch4 UTSW 17 34,795,801 (GRCm39) missense probably benign 0.42
R9434:Notch4 UTSW 17 34,801,673 (GRCm39) missense probably damaging 1.00
R9462:Notch4 UTSW 17 34,806,667 (GRCm39) missense probably benign 0.00
R9664:Notch4 UTSW 17 34,784,601 (GRCm39) missense probably benign 0.07
R9772:Notch4 UTSW 17 34,792,883 (GRCm39) critical splice donor site probably null
X0054:Notch4 UTSW 17 34,803,469 (GRCm39) missense probably damaging 1.00
X0067:Notch4 UTSW 17 34,805,058 (GRCm39) nonsense probably null
Z1088:Notch4 UTSW 17 34,806,889 (GRCm39) missense probably damaging 1.00
Z1177:Notch4 UTSW 17 34,806,883 (GRCm39) missense probably benign 0.04
Z1177:Notch4 UTSW 17 34,806,882 (GRCm39) missense probably damaging 0.97
Z1177:Notch4 UTSW 17 34,794,122 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGTTGTCCTAGCTTGC -3'
(R):5'- ACAGTCGTAGCCATCAAAGAG -3'

Sequencing Primer
(F):5'- TCCTAGCTTGCTTCAGGAAAG -3'
(R):5'- TCCTCAGAGTCACACTGCG -3'
Posted On 2020-07-13