Incidental Mutation 'R8171:Prune2'
ID634167
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Nameprune homolog 2
SynonymsA230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_181348

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8171 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location16956118-17223932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17120518 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1129 (D1129N)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
Predicted Effect probably damaging
Transcript: ENSMUST00000087689
AA Change: D1129N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: D1129N

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,662,025 A661E probably benign Het
4932438A13Rik T C 3: 36,975,713 V2423A probably benign Het
4933425L06Rik T A 13: 105,109,783 V284E probably benign Het
Abhd14a T A 9: 106,440,761 T142S probably benign Het
Actn1 A G 12: 80,196,393 probably null Het
Adss T C 1: 177,796,351 N15S probably benign Het
Alpk2 A G 18: 65,305,983 S780P probably benign Het
Asap1 G T 15: 64,110,966 L830M probably damaging Het
Atic T C 1: 71,569,873 V319A possibly damaging Het
Atp8a2 A T 14: 60,046,044 I87N probably damaging Het
Bace2 G T 16: 97,424,586 V407L possibly damaging Het
Bmp3 A T 5: 98,872,669 Y317F probably damaging Het
Ccdc159 A G 9: 21,933,711 E291G possibly damaging Het
Cct8l1 T A 5: 25,516,554 L89Q probably damaging Het
Cep83 T A 10: 94,768,935 N503K possibly damaging Het
Ces4a A G 8: 105,147,207 Y436C probably damaging Het
Cftr T A 6: 18,258,288 D579E probably damaging Het
Chd9 T A 8: 91,025,387 V1751D possibly damaging Het
Clasp2 A T 9: 113,903,906 T937S possibly damaging Het
Clock T A 5: 76,266,414 D17V possibly damaging Het
Cpm T C 10: 117,683,315 L376P probably damaging Het
Crocc2 T C 1: 93,189,001 probably null Het
Csnk1g2 A G 10: 80,639,802 D401G probably damaging Het
Cyb5r4 C T 9: 87,042,810 L206F possibly damaging Het
Cyp1a1 T A 9: 57,700,196 W36R probably benign Het
Cyp3a59 A T 5: 146,085,774 H30L probably damaging Het
Dab2 G A 15: 6,423,926 V182I probably benign Het
Dnah1 G T 14: 31,297,110 F1342L probably damaging Het
Draxin A T 4: 148,115,666 L109Q possibly damaging Het
Elfn1 G A 5: 139,971,357 V39M probably damaging Het
Erlin1 A G 19: 44,069,329 I19T probably benign Het
F830016B08Rik T A 18: 60,300,078 S78T possibly damaging Het
Fer1l4 A G 2: 156,048,231 V258A probably benign Het
Fgb T C 3: 83,042,515 D445G probably damaging Het
Fgd6 T C 10: 94,074,332 probably null Het
Frem3 T A 8: 80,615,240 D1387E probably damaging Het
Gdf3 T C 6: 122,609,903 T22A probably benign Het
Glcci1 C T 6: 8,593,167 A511V probably benign Het
Gldc A T 19: 30,133,761 N538K probably benign Het
Glipr1l1 C T 10: 112,078,384 P217S probably benign Het
Gm15800 A G 5: 121,318,756 E728G possibly damaging Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr161 A G 1: 165,306,436 N89S probably damaging Het
Gypa T A 8: 80,509,463 S166T probably benign Het
Hcar1 A G 5: 123,879,089 S180P probably damaging Het
Hcn1 T C 13: 117,602,734 S11P unknown Het
Itih1 A T 14: 30,937,090 M323K possibly damaging Het
Ivl A G 3: 92,571,778 S327P probably damaging Het
Kcnt2 T A 1: 140,509,465 N545K probably benign Het
Kdm4b A T 17: 56,389,534 R417W probably damaging Het
Kif13a T C 13: 46,778,968 E1083G probably damaging Het
Klhl40 A T 9: 121,778,557 H261L probably benign Het
Kpnb1 A G 11: 97,175,747 probably null Het
Lamc3 C A 2: 31,914,971 T621N probably benign Het
Lingo3 T C 10: 80,834,761 H445R probably benign Het
Ly75 G A 2: 60,314,228 T1297I possibly damaging Het
Lypd6 C T 2: 50,190,747 T149M possibly damaging Het
Mcrs1 A T 15: 99,248,732 D139E probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Mybpc1 C T 10: 88,523,003 G1095R probably damaging Het
Myh1 A G 11: 67,202,572 Y163C probably damaging Het
Notch4 T A 17: 34,582,509 C1110* probably null Het
Olfr1257 A G 2: 89,881,065 I80V probably benign Het
Olfr527 A T 7: 140,336,230 I123F probably damaging Het
Olfr705 C T 7: 106,714,618 S21N probably benign Het
Olfr705 T A 7: 106,714,619 S21C Het
Pcsk1 T A 13: 75,090,091 C10* probably null Het
Pdlim5 A T 3: 142,312,187 S107T probably benign Het
Plac8l1 T A 18: 42,180,380 D99V probably damaging Het
Plin2 A T 4: 86,657,112 V400E probably damaging Het
Plxna1 G A 6: 89,357,120 P176S probably benign Het
Pnn A G 12: 59,070,437 K238R probably damaging Het
Pou5f1 A G 17: 35,510,036 E231G probably benign Het
Ppara A T 15: 85,797,876 M258L probably benign Het
Rai14 G A 15: 10,633,163 T47M probably damaging Het
Rdh5 T C 10: 128,918,100 I117V probably benign Het
Rpain G A 11: 70,973,898 C137Y probably damaging Het
Scn3a A G 2: 65,530,810 V126A possibly damaging Het
Senp7 G T 16: 56,111,726 L129F probably damaging Het
Setd1a A G 7: 127,791,227 D1025G unknown Het
Sirt4 A T 5: 115,483,023 V30E probably damaging Het
Slit1 C A 19: 41,727,073 R113L probably damaging Het
Stxbp5l G A 16: 37,208,054 T549I noncoding transcript Het
Sytl2 A G 7: 90,409,470 M926V probably damaging Het
Tgfbr2 C T 9: 116,130,006 W113* probably null Het
Tmem86a A G 7: 47,053,764 Y213C probably damaging Het
Tpo T A 12: 30,104,046 Y220F probably damaging Het
Ttc6 C A 12: 57,673,310 A889E probably damaging Het
Tyw1 A G 5: 130,300,014 D547G probably benign Het
Ubtfl1 A G 9: 18,409,227 K17R probably benign Het
Usp46 T A 5: 74,002,693 I331F probably benign Het
Vmn2r111 T C 17: 22,573,092 H61R probably benign Het
Vwa9 A T 9: 64,973,250 H213L possibly damaging Het
Wdr75 T A 1: 45,822,546 N715K probably benign Het
Zfp772 A T 7: 7,204,097 C198* probably null Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense probably benign 0.39
R7102:Prune2 UTSW 19 17121213 missense probably benign 0.24
R7246:Prune2 UTSW 19 17121368 missense probably damaging 0.99
R7284:Prune2 UTSW 19 17119886 missense probably damaging 1.00
R7295:Prune2 UTSW 19 17119897 missense probably benign 0.01
R7371:Prune2 UTSW 19 17119370 missense probably benign 0.02
R7651:Prune2 UTSW 19 17120408 missense probably damaging 1.00
R7830:Prune2 UTSW 19 17122674 missense probably benign 0.21
R7872:Prune2 UTSW 19 17119434 missense probably benign 0.05
R7881:Prune2 UTSW 19 17123029 missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17178859 missense probably damaging 0.99
R7969:Prune2 UTSW 19 17201670 missense probably damaging 0.98
R8092:Prune2 UTSW 19 17119993 missense probably damaging 1.00
R8110:Prune2 UTSW 19 17120719 missense probably benign 0.22
R8115:Prune2 UTSW 19 17123924 missense probably benign 0.02
R8129:Prune2 UTSW 19 17118836 missense probably benign 0.01
R8169:Prune2 UTSW 19 17125091 missense probably benign 0.10
R8176:Prune2 UTSW 19 17118292 missense probably damaging 1.00
R8200:Prune2 UTSW 19 17124973 missense probably benign 0.01
R8217:Prune2 UTSW 19 17120116 missense probably benign 0.01
R8258:Prune2 UTSW 19 17212308 missense unknown
R8259:Prune2 UTSW 19 17212308 missense unknown
R8289:Prune2 UTSW 19 17123009 missense probably benign 0.43
R8329:Prune2 UTSW 19 17121265 missense probably benign 0.02
R8342:Prune2 UTSW 19 17125663 missense probably benign 0.01
R8558:Prune2 UTSW 19 17122238 missense probably damaging 0.98
R8732:Prune2 UTSW 19 17120405 missense probably damaging 1.00
R8743:Prune2 UTSW 19 17119556 missense probably benign 0.22
R8769:Prune2 UTSW 19 17123078 missense probably damaging 0.96
R8862:Prune2 UTSW 19 17120146 missense probably benign 0.04
R8936:Prune2 UTSW 19 17121835 missense probably benign 0.24
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCACCCAGATAGCGATGC -3'
(R):5'- GATCCCAGTCTACCTGATTTGC -3'

Sequencing Primer
(F):5'- ACAAAAATGCTTCCATGGAGG -3'
(R):5'- AGTCTACCTGATTTGCTTCCTGATG -3'
Posted On2020-07-13