Mutagenetix > Incidental Mutation

Incidental Mutation 'R8171:Prune2'

634167

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8171 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 17120518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1129 (D1129N)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: D1129N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: D1129N

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	G	T	14: 32,662,025	A661E	probably benign	Het
4932438A13Rik	T	C	3: 36,975,713	V2423A	probably benign	Het
4933425L06Rik	T	A	13: 105,109,783	V284E	probably benign	Het
Abhd14a	T	A	9: 106,440,761	T142S	probably benign	Het
Actn1	A	G	12: 80,196,393		probably null	Het
Adss	T	C	1: 177,796,351	N15S	probably benign	Het
Alpk2	A	G	18: 65,305,983	S780P	probably benign	Het
Asap1	G	T	15: 64,110,966	L830M	probably damaging	Het
Atic	T	C	1: 71,569,873	V319A	possibly damaging	Het
Atp8a2	A	T	14: 60,046,044	I87N	probably damaging	Het
Bace2	G	T	16: 97,424,586	V407L	possibly damaging	Het
Bmp3	A	T	5: 98,872,669	Y317F	probably damaging	Het
Ccdc159	A	G	9: 21,933,711	E291G	possibly damaging	Het
Cct8l1	T	A	5: 25,516,554	L89Q	probably damaging	Het
Cep83	T	A	10: 94,768,935	N503K	possibly damaging	Het
Ces4a	A	G	8: 105,147,207	Y436C	probably damaging	Het
Cftr	T	A	6: 18,258,288	D579E	probably damaging	Het
Chd9	T	A	8: 91,025,387	V1751D	possibly damaging	Het
Clasp2	A	T	9: 113,903,906	T937S	possibly damaging	Het
Clock	T	A	5: 76,266,414	D17V	possibly damaging	Het
Cpm	T	C	10: 117,683,315	L376P	probably damaging	Het
Crocc2	T	C	1: 93,189,001		probably null	Het
Csnk1g2	A	G	10: 80,639,802	D401G	probably damaging	Het
Cyb5r4	C	T	9: 87,042,810	L206F	possibly damaging	Het
Cyp1a1	T	A	9: 57,700,196	W36R	probably benign	Het
Cyp3a59	A	T	5: 146,085,774	H30L	probably damaging	Het
Dab2	G	A	15: 6,423,926	V182I	probably benign	Het
Dnah1	G	T	14: 31,297,110	F1342L	probably damaging	Het
Draxin	A	T	4: 148,115,666	L109Q	possibly damaging	Het
Elfn1	G	A	5: 139,971,357	V39M	probably damaging	Het
Erlin1	A	G	19: 44,069,329	I19T	probably benign	Het
F830016B08Rik	T	A	18: 60,300,078	S78T	possibly damaging	Het
Fer1l4	A	G	2: 156,048,231	V258A	probably benign	Het
Fgb	T	C	3: 83,042,515	D445G	probably damaging	Het
Fgd6	T	C	10: 94,074,332		probably null	Het
Frem3	T	A	8: 80,615,240	D1387E	probably damaging	Het
Gdf3	T	C	6: 122,609,903	T22A	probably benign	Het
Glcci1	C	T	6: 8,593,167	A511V	probably benign	Het
Gldc	A	T	19: 30,133,761	N538K	probably benign	Het
Glipr1l1	C	T	10: 112,078,384	P217S	probably benign	Het
Gm35339	C	A	15: 76,363,619	F1614L		Het
Gpr161	A	G	1: 165,306,436	N89S	probably damaging	Het
Gypa	T	A	8: 80,509,463	S166T	probably benign	Het
Hcar1	A	G	5: 123,879,089	S180P	probably damaging	Het
Hcn1	T	C	13: 117,602,734	S11P	unknown	Het
Hectd4	A	G	5: 121,318,756	E728G	possibly damaging	Het
Ints14	A	T	9: 64,973,250	H213L	possibly damaging	Het
Itih1	A	T	14: 30,937,090	M323K	possibly damaging	Het
Ivl	A	G	3: 92,571,778	S327P	probably damaging	Het
Kcnt2	T	A	1: 140,509,465	N545K	probably benign	Het
Kdm4b	A	T	17: 56,389,534	R417W	probably damaging	Het
Kif13a	T	C	13: 46,778,968	E1083G	probably damaging	Het
Klhl40	A	T	9: 121,778,557	H261L	probably benign	Het
Kpnb1	A	G	11: 97,175,747		probably null	Het
Lamc3	C	A	2: 31,914,971	T621N	probably benign	Het
Lingo3	T	C	10: 80,834,761	H445R	probably benign	Het
Ly75	G	A	2: 60,314,228	T1297I	possibly damaging	Het
Lypd6	C	T	2: 50,190,747	T149M	possibly damaging	Het
Mcrs1	A	T	15: 99,248,732	D139E	probably damaging	Het
Muc5b	G	A	7: 141,861,000	S2561N	unknown	Het
Mybpc1	C	T	10: 88,523,003	G1095R	probably damaging	Het
Myh1	A	G	11: 67,202,572	Y163C	probably damaging	Het
Notch4	T	A	17: 34,582,509	C1110*	probably null	Het
Olfr1257	A	G	2: 89,881,065	I80V	probably benign	Het
Olfr527	A	T	7: 140,336,230	I123F	probably damaging	Het
Olfr705	C	T	7: 106,714,618	S21N	probably benign	Het
Olfr705	T	A	7: 106,714,619	S21C		Het
Pcsk1	T	A	13: 75,090,091	C10*	probably null	Het
Pdlim5	A	T	3: 142,312,187	S107T	probably benign	Het
Plac8l1	T	A	18: 42,180,380	D99V	probably damaging	Het
Plin2	A	T	4: 86,657,112	V400E	probably damaging	Het
Plxna1	G	A	6: 89,357,120	P176S	probably benign	Het
Pnn	A	G	12: 59,070,437	K238R	probably damaging	Het
Pou5f1	A	G	17: 35,510,036	E231G	probably benign	Het
Ppara	A	T	15: 85,797,876	M258L	probably benign	Het
Rai14	G	A	15: 10,633,163	T47M	probably damaging	Het
Rdh5	T	C	10: 128,918,100	I117V	probably benign	Het
Rpain	G	A	11: 70,973,898	C137Y	probably damaging	Het
Scn3a	A	G	2: 65,530,810	V126A	possibly damaging	Het
Senp7	G	T	16: 56,111,726	L129F	probably damaging	Het
Setd1a	A	G	7: 127,791,227	D1025G	unknown	Het
Sirt4	A	T	5: 115,483,023	V30E	probably damaging	Het
Slit1	C	A	19: 41,727,073	R113L	probably damaging	Het
Stxbp5l	G	A	16: 37,208,054	T549I	noncoding transcript	Het
Sytl2	A	G	7: 90,409,470	M926V	probably damaging	Het
Tgfbr2	C	T	9: 116,130,006	W113*	probably null	Het
Tmem86a	A	G	7: 47,053,764	Y213C	probably damaging	Het
Tpo	T	A	12: 30,104,046	Y220F	probably damaging	Het
Ttc6	C	A	12: 57,673,310	A889E	probably damaging	Het
Tyw1	A	G	5: 130,300,014	D547G	probably benign	Het
Ubtfl1	A	G	9: 18,409,227	K17R	probably benign	Het
Usp46	T	A	5: 74,002,693	I331F	probably benign	Het
Vmn2r111	T	C	17: 22,573,092	H61R	probably benign	Het
Wdr75	T	A	1: 45,822,546	N715K	probably benign	Het
Zfp772	A	T	7: 7,204,097	C198*	probably null	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCACCCAGATAGCGATGC -3'
(R):5'- GATCCCAGTCTACCTGATTTGC -3'

Sequencing Primer
(F):5'- ACAAAAATGCTTCCATGGAGG -3'
(R):5'- AGTCTACCTGATTTGCTTCCTGATG -3'

Posted On

2020-07-13