Incidental Mutation 'R0694:Sema6d'
ID 63418
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms Sema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-4, Sema6D-5, Sema6D-2
MMRRC Submission 038879-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0694 (G1)
Quality Score 147
Status Not validated
Chromosome 2
Chromosomal Location 123931889-124509690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124505961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 633 (S633P)
Ref Sequence ENSEMBL: ENSMUSP00000099528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
AlphaFold Q76KF0
Predicted Effect probably damaging
Transcript: ENSMUST00000051419
AA Change: S590P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200
AA Change: S590P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000076335
AA Change: S577P

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200
AA Change: S577P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000077847
AA Change: S633P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200
AA Change: S633P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000078621
AA Change: S609P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200
AA Change: S609P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103238
AA Change: S633P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200
AA Change: S633P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103239
AA Change: S652P

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200
AA Change: S652P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103240
AA Change: S648P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200
AA Change: S648P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103241
AA Change: S577P

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200
AA Change: S577P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132088
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b C T 13: 14,362,419 (GRCm39) T961I probably damaging Het
Asb13 G T 13: 3,699,480 (GRCm39) A227S probably benign Het
Atp6v1g1 C T 4: 63,468,230 (GRCm39) R78W probably benign Het
Bglap2 C T 3: 88,285,723 (GRCm39) D31N possibly damaging Het
Dsn1 T C 2: 156,847,789 (GRCm39) T2A possibly damaging Het
Fbxo22 T A 9: 55,128,423 (GRCm39) I248N probably damaging Het
Fbxo39 G A 11: 72,209,295 (GRCm39) R385Q probably benign Het
Glyr1 T C 16: 4,844,424 (GRCm39) N284S probably damaging Het
Hus1 C T 11: 8,957,531 (GRCm39) W144* probably null Het
Kcna1 T C 6: 126,619,208 (GRCm39) T371A probably damaging Het
Prkdc A T 16: 15,586,501 (GRCm39) N2510I probably damaging Het
Ptprn2 G T 12: 116,787,975 (GRCm39) A105S possibly damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Sulf2 T C 2: 165,927,711 (GRCm39) N362S probably damaging Het
Tlcd5 C T 9: 43,022,921 (GRCm39) W126* probably null Het
Trim50 A T 5: 135,382,399 (GRCm39) I84L probably benign Het
Trpc3 A T 3: 36,725,704 (GRCm39) F91I possibly damaging Het
Zfp804a A G 2: 81,884,148 (GRCm39) Y5C probably damaging Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124,501,785 (GRCm39) missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124,498,844 (GRCm39) splice site probably benign
IGL00710:Sema6d APN 2 124,504,208 (GRCm39) missense probably benign 0.00
IGL00811:Sema6d APN 2 124,500,389 (GRCm39) missense probably damaging 1.00
IGL01457:Sema6d APN 2 124,495,562 (GRCm39) missense unknown
IGL01524:Sema6d APN 2 124,505,995 (GRCm39) missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124,507,018 (GRCm39) missense probably damaging 1.00
IGL01915:Sema6d APN 2 124,500,491 (GRCm39) splice site probably benign
IGL02365:Sema6d APN 2 124,498,788 (GRCm39) missense probably benign 0.14
IGL02698:Sema6d APN 2 124,495,643 (GRCm39) missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124,505,993 (GRCm39) missense probably damaging 1.00
IGL03018:Sema6d APN 2 124,501,520 (GRCm39) missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124,506,290 (GRCm39) missense possibly damaging 0.83
R0269:Sema6d UTSW 2 124,502,665 (GRCm39) missense possibly damaging 0.63
R0390:Sema6d UTSW 2 124,500,410 (GRCm39) missense probably damaging 1.00
R0541:Sema6d UTSW 2 124,507,197 (GRCm39) missense probably benign 0.25
R0615:Sema6d UTSW 2 124,496,055 (GRCm39) splice site probably benign
R0617:Sema6d UTSW 2 124,502,665 (GRCm39) missense possibly damaging 0.63
R0854:Sema6d UTSW 2 124,507,222 (GRCm39) missense probably damaging 0.97
R1630:Sema6d UTSW 2 124,506,265 (GRCm39) missense possibly damaging 0.89
R1682:Sema6d UTSW 2 124,507,069 (GRCm39) missense probably benign 0.21
R1823:Sema6d UTSW 2 124,501,476 (GRCm39) splice site probably null
R1932:Sema6d UTSW 2 124,501,806 (GRCm39) critical splice donor site probably null
R2249:Sema6d UTSW 2 124,501,508 (GRCm39) missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124,506,070 (GRCm39) missense probably damaging 1.00
R2331:Sema6d UTSW 2 124,499,983 (GRCm39) missense probably damaging 1.00
R2910:Sema6d UTSW 2 124,506,957 (GRCm39) missense probably damaging 1.00
R3683:Sema6d UTSW 2 124,496,146 (GRCm39) missense possibly damaging 0.88
R3937:Sema6d UTSW 2 124,498,770 (GRCm39) missense probably benign 0.00
R4135:Sema6d UTSW 2 124,506,040 (GRCm39) missense probably damaging 0.96
R4446:Sema6d UTSW 2 124,505,979 (GRCm39) missense probably damaging 0.98
R4583:Sema6d UTSW 2 124,506,082 (GRCm39) missense probably damaging 1.00
R4599:Sema6d UTSW 2 124,496,151 (GRCm39) missense probably damaging 1.00
R4822:Sema6d UTSW 2 124,504,214 (GRCm39) missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124,498,738 (GRCm39) splice site probably null
R5288:Sema6d UTSW 2 124,506,166 (GRCm39) missense probably damaging 1.00
R5443:Sema6d UTSW 2 124,498,756 (GRCm39) missense probably damaging 1.00
R5504:Sema6d UTSW 2 124,499,941 (GRCm39) missense probably damaging 1.00
R5534:Sema6d UTSW 2 124,501,735 (GRCm39) missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124,498,821 (GRCm39) missense probably damaging 0.97
R5747:Sema6d UTSW 2 124,506,867 (GRCm39) missense probably damaging 0.99
R5866:Sema6d UTSW 2 124,506,262 (GRCm39) missense probably benign 0.26
R5980:Sema6d UTSW 2 124,506,628 (GRCm39) missense probably damaging 1.00
R6670:Sema6d UTSW 2 124,496,762 (GRCm39) small deletion probably benign
R6803:Sema6d UTSW 2 124,505,970 (GRCm39) missense probably damaging 0.96
R7023:Sema6d UTSW 2 124,506,831 (GRCm39) missense probably damaging 1.00
R7068:Sema6d UTSW 2 124,499,741 (GRCm39) missense probably benign
R7426:Sema6d UTSW 2 124,496,078 (GRCm39) missense probably damaging 1.00
R7556:Sema6d UTSW 2 124,496,109 (GRCm39) missense probably damaging 1.00
R7569:Sema6d UTSW 2 124,499,892 (GRCm39) missense possibly damaging 0.92
R8427:Sema6d UTSW 2 124,507,197 (GRCm39) missense probably benign 0.25
R8690:Sema6d UTSW 2 124,506,937 (GRCm39) missense probably benign 0.07
R8711:Sema6d UTSW 2 124,502,232 (GRCm39) missense possibly damaging 0.54
R8757:Sema6d UTSW 2 124,497,134 (GRCm39) missense probably damaging 1.00
R8759:Sema6d UTSW 2 124,497,134 (GRCm39) missense probably damaging 1.00
R8868:Sema6d UTSW 2 124,496,114 (GRCm39) missense probably damaging 1.00
R9511:Sema6d UTSW 2 124,499,943 (GRCm39) missense probably damaging 1.00
R9586:Sema6d UTSW 2 124,496,096 (GRCm39) missense probably damaging 1.00
R9731:Sema6d UTSW 2 124,506,117 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAACAACTGCGTAAGAGATGGGG -3'
(R):5'- TGTCAAAGAGGCCGTTCAGCTTG -3'

Sequencing Primer
(F):5'- AAATTTAATTGTGACTTCAGGGGGC -3'
(R):5'- AAGCTTCCGCTGGAGTCTG -3'
Posted On 2013-07-30