Incidental Mutation 'R8172:Flg2'
ID 634180
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 067598-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R8172 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93108468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 165 (D165E)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000098884
AA Change: D165E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: D165E

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
AA Change: D108E
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133
AA Change: D108E

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T A 16: 34,977,427 (GRCm39) L320Q probably damaging Het
Adgre4 A T 17: 56,104,769 (GRCm39) L278F probably benign Het
Agfg2 C A 5: 137,665,431 (GRCm39) R108L probably damaging Het
Arap2 A T 5: 62,779,324 (GRCm39) probably null Het
Ascl2 G T 7: 142,522,336 (GRCm39) N37K possibly damaging Het
Baiap3 C A 17: 25,463,096 (GRCm39) D1043Y probably damaging Het
Cby2 T A 14: 75,829,241 (GRCm39) probably null Het
Ccdc18 T C 5: 108,311,640 (GRCm39) probably null Het
Cemip T A 7: 83,646,433 (GRCm39) D205V probably damaging Het
Cenpn G A 8: 117,658,333 (GRCm39) G93D probably benign Het
Clpsl2 T A 17: 28,768,556 (GRCm39) S23R possibly damaging Het
Cnot3 T A 7: 3,661,724 (GRCm39) I672N possibly damaging Het
Crygs A G 16: 22,625,292 (GRCm39) Y50H probably damaging Het
Cyp4x1 T C 4: 114,968,874 (GRCm39) T403A possibly damaging Het
Dnajc28 G A 16: 91,413,795 (GRCm39) R150* probably null Het
Fam184b C T 5: 45,741,709 (GRCm39) G174D possibly damaging Het
Fat2 T A 11: 55,178,638 (GRCm39) D1474V probably damaging Het
Fpr-rs7 A T 17: 20,334,443 (GRCm39) F16I probably benign Het
Gpr176 G A 2: 118,114,615 (GRCm39) T65I probably damaging Het
H2-Q10 C T 17: 35,781,996 (GRCm39) T206I probably null Het
Hadha C G 5: 30,350,285 (GRCm39) A88P probably damaging Het
Hlcs A T 16: 94,068,485 (GRCm39) L245Q probably damaging Het
Hnrnph1 T C 11: 50,270,732 (GRCm39) V113A probably damaging Het
Hsd3b7 G A 7: 127,401,546 (GRCm39) V224M probably damaging Het
Igha T C 12: 113,223,592 (GRCm39) D88G Het
Iqca1l T C 5: 24,748,608 (GRCm39) M803V probably benign Het
Kdm7a T C 6: 39,125,965 (GRCm39) K610R probably benign Het
Krt87 C T 15: 101,383,284 (GRCm39) C474Y probably benign Het
Lrrc74a T A 12: 86,788,530 (GRCm39) L170H probably damaging Het
Lyg2 T C 1: 37,946,748 (GRCm39) T178A probably benign Het
Map2k2 T A 10: 80,959,442 (GRCm39) probably null Het
Mast4 C T 13: 103,089,633 (GRCm39) probably null Het
Mtmr14 T A 6: 113,216,529 (GRCm39) D8E probably benign Het
Neu2 C T 1: 87,524,633 (GRCm39) P206L probably damaging Het
Oga C T 19: 45,765,339 (GRCm39) R156H probably damaging Het
Or10al6 A G 17: 38,083,326 (GRCm39) T261A probably benign Het
Or4c105 A T 2: 88,647,986 (GRCm39) Q157L probably damaging Het
Poc1b C A 10: 98,980,338 (GRCm39) probably null Het
Proser1 T A 3: 53,386,272 (GRCm39) V718E possibly damaging Het
Ptgr2 T A 12: 84,360,783 (GRCm39) L351Q possibly damaging Het
Ptprf A G 4: 118,068,275 (GRCm39) Y1754H probably benign Het
Scgb2b3 T C 7: 31,058,476 (GRCm39) K109R possibly damaging Het
Scn2a A T 2: 65,520,672 (GRCm39) H556L probably benign Het
Scn7a A T 2: 66,506,191 (GRCm39) M1566K possibly damaging Het
Slco5a1 A T 1: 13,060,490 (GRCm39) L77* probably null Het
Stk31 T C 6: 49,394,261 (GRCm39) F208L possibly damaging Het
Tbcd C T 11: 121,384,711 (GRCm39) T315M probably benign Het
Tbx4 A G 11: 85,801,933 (GRCm39) I189V probably benign Het
Tia1 T A 6: 86,404,682 (GRCm39) Y306N probably benign Het
Ttc21b T A 2: 66,082,500 (GRCm39) Y33F probably benign Het
Usp47 T A 7: 111,687,133 (GRCm39) L677* probably null Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTTCAGGGTCAAAGAAGC -3'
(R):5'- CCCTGGTGGTTTAACCTATATCCAG -3'

Sequencing Primer
(F):5'- GTGGCCATCAACACCAAGAGG -3'
(R):5'- ATATCCAGACTCATACTCTTCCTCAG -3'
Posted On 2020-07-13