Incidental Mutation 'R8172:Ccdc18'
ID 634186
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 1700021E15Rik, 4932411G06Rik
MMRRC Submission 067598-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8172 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 108280741-108381494 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108311640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677] [ENSMUST00000197718]
AlphaFold Q640L5
Predicted Effect probably null
Transcript: ENSMUST00000047677
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197718
SMART Domains Protein: ENSMUSP00000142963
Gene: ENSMUSG00000056531

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T A 16: 34,977,427 (GRCm39) L320Q probably damaging Het
Adgre4 A T 17: 56,104,769 (GRCm39) L278F probably benign Het
Agfg2 C A 5: 137,665,431 (GRCm39) R108L probably damaging Het
Arap2 A T 5: 62,779,324 (GRCm39) probably null Het
Ascl2 G T 7: 142,522,336 (GRCm39) N37K possibly damaging Het
Baiap3 C A 17: 25,463,096 (GRCm39) D1043Y probably damaging Het
Cby2 T A 14: 75,829,241 (GRCm39) probably null Het
Cemip T A 7: 83,646,433 (GRCm39) D205V probably damaging Het
Cenpn G A 8: 117,658,333 (GRCm39) G93D probably benign Het
Clpsl2 T A 17: 28,768,556 (GRCm39) S23R possibly damaging Het
Cnot3 T A 7: 3,661,724 (GRCm39) I672N possibly damaging Het
Crygs A G 16: 22,625,292 (GRCm39) Y50H probably damaging Het
Cyp4x1 T C 4: 114,968,874 (GRCm39) T403A possibly damaging Het
Dnajc28 G A 16: 91,413,795 (GRCm39) R150* probably null Het
Fam184b C T 5: 45,741,709 (GRCm39) G174D possibly damaging Het
Fat2 T A 11: 55,178,638 (GRCm39) D1474V probably damaging Het
Flg2 T A 3: 93,108,468 (GRCm39) D165E possibly damaging Het
Fpr-rs7 A T 17: 20,334,443 (GRCm39) F16I probably benign Het
Gpr176 G A 2: 118,114,615 (GRCm39) T65I probably damaging Het
H2-Q10 C T 17: 35,781,996 (GRCm39) T206I probably null Het
Hadha C G 5: 30,350,285 (GRCm39) A88P probably damaging Het
Hlcs A T 16: 94,068,485 (GRCm39) L245Q probably damaging Het
Hnrnph1 T C 11: 50,270,732 (GRCm39) V113A probably damaging Het
Hsd3b7 G A 7: 127,401,546 (GRCm39) V224M probably damaging Het
Igha T C 12: 113,223,592 (GRCm39) D88G Het
Iqca1l T C 5: 24,748,608 (GRCm39) M803V probably benign Het
Kdm7a T C 6: 39,125,965 (GRCm39) K610R probably benign Het
Krt87 C T 15: 101,383,284 (GRCm39) C474Y probably benign Het
Lrrc74a T A 12: 86,788,530 (GRCm39) L170H probably damaging Het
Lyg2 T C 1: 37,946,748 (GRCm39) T178A probably benign Het
Map2k2 T A 10: 80,959,442 (GRCm39) probably null Het
Mast4 C T 13: 103,089,633 (GRCm39) probably null Het
Mtmr14 T A 6: 113,216,529 (GRCm39) D8E probably benign Het
Neu2 C T 1: 87,524,633 (GRCm39) P206L probably damaging Het
Oga C T 19: 45,765,339 (GRCm39) R156H probably damaging Het
Or10al6 A G 17: 38,083,326 (GRCm39) T261A probably benign Het
Or4c105 A T 2: 88,647,986 (GRCm39) Q157L probably damaging Het
Poc1b C A 10: 98,980,338 (GRCm39) probably null Het
Proser1 T A 3: 53,386,272 (GRCm39) V718E possibly damaging Het
Ptgr2 T A 12: 84,360,783 (GRCm39) L351Q possibly damaging Het
Ptprf A G 4: 118,068,275 (GRCm39) Y1754H probably benign Het
Scgb2b3 T C 7: 31,058,476 (GRCm39) K109R possibly damaging Het
Scn2a A T 2: 65,520,672 (GRCm39) H556L probably benign Het
Scn7a A T 2: 66,506,191 (GRCm39) M1566K possibly damaging Het
Slco5a1 A T 1: 13,060,490 (GRCm39) L77* probably null Het
Stk31 T C 6: 49,394,261 (GRCm39) F208L possibly damaging Het
Tbcd C T 11: 121,384,711 (GRCm39) T315M probably benign Het
Tbx4 A G 11: 85,801,933 (GRCm39) I189V probably benign Het
Tia1 T A 6: 86,404,682 (GRCm39) Y306N probably benign Het
Ttc21b T A 2: 66,082,500 (GRCm39) Y33F probably benign Het
Usp47 T A 7: 111,687,133 (GRCm39) L677* probably null Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108,328,391 (GRCm39) missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108,328,753 (GRCm39) missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108,350,052 (GRCm39) splice site probably benign
IGL01718:Ccdc18 APN 5 108,349,214 (GRCm39) missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108,349,977 (GRCm39) missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108,296,788 (GRCm39) missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108,283,918 (GRCm39) missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108,319,614 (GRCm39) missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108,283,835 (GRCm39) splice site probably benign
IGL02880:Ccdc18 APN 5 108,283,310 (GRCm39) missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108,376,767 (GRCm39) missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108,359,997 (GRCm39) missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108,306,485 (GRCm39) missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108,309,566 (GRCm39) missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108,321,627 (GRCm39) missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108,321,655 (GRCm39) missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108,322,830 (GRCm39) missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108,328,282 (GRCm39) missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108,322,853 (GRCm39) missense probably damaging 1.00
R0648:Ccdc18 UTSW 5 108,283,426 (GRCm39) missense probably damaging 0.99
R0666:Ccdc18 UTSW 5 108,311,530 (GRCm39) missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108,349,982 (GRCm39) nonsense probably null
R1509:Ccdc18 UTSW 5 108,336,844 (GRCm39) missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108,339,843 (GRCm39) missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108,360,054 (GRCm39) missense probably benign
R1663:Ccdc18 UTSW 5 108,363,956 (GRCm39) missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108,341,668 (GRCm39) missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108,368,703 (GRCm39) missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108,343,908 (GRCm39) missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108,376,861 (GRCm39) missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4079:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4244:Ccdc18 UTSW 5 108,296,838 (GRCm39) nonsense probably null
R4409:Ccdc18 UTSW 5 108,368,708 (GRCm39) nonsense probably null
R4428:Ccdc18 UTSW 5 108,283,943 (GRCm39) missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108,309,395 (GRCm39) missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108,376,826 (GRCm39) missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108,283,307 (GRCm39) missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108,284,007 (GRCm39) missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108,339,869 (GRCm39) missense probably benign
R5039:Ccdc18 UTSW 5 108,306,514 (GRCm39) critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108,288,740 (GRCm39) missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108,354,594 (GRCm39) missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108,311,625 (GRCm39) missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108,319,484 (GRCm39) missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108,322,753 (GRCm39) missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108,309,448 (GRCm39) missense probably benign
R6359:Ccdc18 UTSW 5 108,283,391 (GRCm39) missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108,322,820 (GRCm39) missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108,349,214 (GRCm39) missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108,309,612 (GRCm39) missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108,339,790 (GRCm39) missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108,286,796 (GRCm39) missense probably benign
R6664:Ccdc18 UTSW 5 108,315,966 (GRCm39) nonsense probably null
R6836:Ccdc18 UTSW 5 108,345,833 (GRCm39) missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108,309,401 (GRCm39) missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108,321,728 (GRCm39) critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108,309,554 (GRCm39) missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108,341,664 (GRCm39) missense probably benign
R7087:Ccdc18 UTSW 5 108,343,988 (GRCm39) missense probably benign
R7117:Ccdc18 UTSW 5 108,296,835 (GRCm39) missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108,315,972 (GRCm39) missense probably benign
R7382:Ccdc18 UTSW 5 108,286,873 (GRCm39) missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108,368,716 (GRCm39) missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108,354,483 (GRCm39) nonsense probably null
R7506:Ccdc18 UTSW 5 108,311,605 (GRCm39) missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108,376,915 (GRCm39) critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108,376,528 (GRCm39) missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108,296,907 (GRCm39) critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108,328,699 (GRCm39) missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8019:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8177:Ccdc18 UTSW 5 108,345,661 (GRCm39) missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108,309,369 (GRCm39) missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108,363,899 (GRCm39) missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108,345,725 (GRCm39) missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108,328,283 (GRCm39) missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108,296,856 (GRCm39) missense probably damaging 0.98
R9391:Ccdc18 UTSW 5 108,376,770 (GRCm39) missense probably benign 0.02
R9418:Ccdc18 UTSW 5 108,303,669 (GRCm39) missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108,286,792 (GRCm39) missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108,339,800 (GRCm39) missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108,368,582 (GRCm39) missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108,339,788 (GRCm39) missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108,360,063 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTGTTAAGAAGAAGACAGTTGTA -3'
(R):5'- GAACCAAATTTAACTTGGGTAGTAAGT -3'

Sequencing Primer
(F):5'- CTTTGTAAGCACCAGAGGA -3'
(R):5'- AGAGTACTGACTGCTCTTCCAGAG -3'
Posted On 2020-07-13