Mutagenetix > Incidental Mutation

Incidental Mutation 'R0694:Dsn1'

63419

Institutional Source

Beutler Lab

Gene Symbol

Dsn1

Ensembl Gene

ENSMUSG00000027635

Gene Name

DSN1 homolog, MIS12 kinetochore complex component

Synonyms

1700022L09Rik

MMRRC Submission

038879-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R0694 (G1)

Quality Score

146

Status

Not validated

Chromosome

Chromosomal Location

156837185-156849074 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 156847789 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2 (T2A)

Ref Sequence

ENSEMBL: ENSMUSP00000122593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103129] [ENSMUST00000103130] [ENSMUST00000124671] [ENSMUST00000146413] [ENSMUST00000154213]

AlphaFold

Q9CYC5

Predicted Effect

probably benign
Transcript: ENSMUST00000103129
AA Change: T2A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000099418
Gene: ENSMUSG00000027635
AA Change: T2A

Domain	Start	End	E-Value	Type
Pfam:MIS13	72	348	4.5e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000103130
AA Change: T2A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000099419
Gene: ENSMUSG00000027635
AA Change: T2A

Domain	Start	End	E-Value	Type
Pfam:MIS13	72	348	4.5e-68	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124671
AA Change: T2A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120354
Gene: ENSMUSG00000027635
AA Change: T2A

Domain	Start	End	E-Value	Type
Pfam:MIS13	72	124	2.7e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141388

Predicted Effect

probably benign
Transcript: ENSMUST00000146413
AA Change: T2A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000122524
Gene: ENSMUSG00000027635
AA Change: T2A

Domain	Start	End	E-Value	Type
Pfam:MIS13	72	199	1.7e-32	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154213
AA Change: T2A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.0596

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.5%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinetochore protein that functions as part of the minichromosome instability-12 centromere complex. The encoded protein is required for proper kinetochore assembly and progression through the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4b	C	T	13: 14,362,419 (GRCm39)	T961I	probably damaging	Het
Asb13	G	T	13: 3,699,480 (GRCm39)	A227S	probably benign	Het
Atp6v1g1	C	T	4: 63,468,230 (GRCm39)	R78W	probably benign	Het
Bglap2	C	T	3: 88,285,723 (GRCm39)	D31N	possibly damaging	Het
Fbxo22	T	A	9: 55,128,423 (GRCm39)	I248N	probably damaging	Het
Fbxo39	G	A	11: 72,209,295 (GRCm39)	R385Q	probably benign	Het
Glyr1	T	C	16: 4,844,424 (GRCm39)	N284S	probably damaging	Het
Hus1	C	T	11: 8,957,531 (GRCm39)	W144*	probably null	Het
Kcna1	T	C	6: 126,619,208 (GRCm39)	T371A	probably damaging	Het
Prkdc	A	T	16: 15,586,501 (GRCm39)	N2510I	probably damaging	Het
Ptprn2	G	T	12: 116,787,975 (GRCm39)	A105S	possibly damaging	Het
Sema6a	G	A	18: 47,423,112 (GRCm39)		probably null	Het
Sema6d	T	C	2: 124,505,961 (GRCm39)	S633P	probably damaging	Het
Sulf2	T	C	2: 165,927,711 (GRCm39)	N362S	probably damaging	Het
Tlcd5	C	T	9: 43,022,921 (GRCm39)	W126*	probably null	Het
Trim50	A	T	5: 135,382,399 (GRCm39)	I84L	probably benign	Het
Trpc3	A	T	3: 36,725,704 (GRCm39)	F91I	possibly damaging	Het
Zfp804a	A	G	2: 81,884,148 (GRCm39)	Y5C	probably damaging	Het

Other mutations in Dsn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01572:Dsn1	APN	2	156,841,054 (GRCm39)	critical splice donor site	probably null
IGL02425:Dsn1	APN	2	156,838,667 (GRCm39)	missense	probably damaging	0.99
BB005:Dsn1	UTSW	2	156,847,932 (GRCm39)	start gained	probably benign
BB015:Dsn1	UTSW	2	156,847,932 (GRCm39)	start gained	probably benign
IGL03014:Dsn1	UTSW	2	156,838,739 (GRCm39)	missense	possibly damaging	0.94
R0421:Dsn1	UTSW	2	156,847,789 (GRCm39)	missense	possibly damaging	0.95
R0519:Dsn1	UTSW	2	156,840,633 (GRCm39)	splice site	probably benign
R1906:Dsn1	UTSW	2	156,838,163 (GRCm39)	missense	probably damaging	1.00
R2043:Dsn1	UTSW	2	156,847,273 (GRCm39)	missense	possibly damaging	0.47
R2930:Dsn1	UTSW	2	156,847,381 (GRCm39)	missense	probably damaging	0.99
R4363:Dsn1	UTSW	2	156,841,062 (GRCm39)	missense	probably benign	0.41
R4749:Dsn1	UTSW	2	156,843,660 (GRCm39)	missense	probably damaging	1.00
R6017:Dsn1	UTSW	2	156,838,162 (GRCm39)	missense	probably damaging	1.00
R6496:Dsn1	UTSW	2	156,847,187 (GRCm39)	missense	probably damaging	0.97
R7562:Dsn1	UTSW	2	156,842,792 (GRCm39)	missense	probably damaging	0.99
R7740:Dsn1	UTSW	2	156,839,636 (GRCm39)	missense	possibly damaging	0.88
R7928:Dsn1	UTSW	2	156,847,932 (GRCm39)	start gained	probably benign
R8496:Dsn1	UTSW	2	156,839,640 (GRCm39)	missense	probably benign	0.41
R9322:Dsn1	UTSW	2	156,843,669 (GRCm39)	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- TCCAAGCCAAGGGTGACAACAG -3'
(R):5'- CCGAGTTCTTGAAGACAGCAGTCAG -3'

Sequencing Primer
(F):5'- AGTTGAAGGACCAGCTTCC -3'
(R):5'- CAGTCAGTGATAGTAATCTTGCTGC -3'

Posted On

2013-07-30