Mutagenetix > Incidental Mutation

Incidental Mutation 'R8172:Mast4'

634206

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

067598-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R8172 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102868994-103471005 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 103089633 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000096808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000164111] [ENSMUST00000166336] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000172264]

AlphaFold

Q811L6

Predicted Effect

probably null
Transcript: ENSMUST00000099202

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164111

SMART Domains

Protein: ENSMUSP00000126625
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166336

SMART Domains

Protein: ENSMUSP00000126516
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	71	212	1.2e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172264

SMART Domains

Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	49	326	4.1e-147	PFAM
S_TKc	364	637	4.13e-98	SMART
S_TK_X	638	702	3.79e-2	SMART
low complexity region	718	731	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	813	830	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194446

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy5	T	A	16: 34,977,427 (GRCm39)	L320Q	probably damaging	Het
Adgre4	A	T	17: 56,104,769 (GRCm39)	L278F	probably benign	Het
Agfg2	C	A	5: 137,665,431 (GRCm39)	R108L	probably damaging	Het
Arap2	A	T	5: 62,779,324 (GRCm39)		probably null	Het
Ascl2	G	T	7: 142,522,336 (GRCm39)	N37K	possibly damaging	Het
Baiap3	C	A	17: 25,463,096 (GRCm39)	D1043Y	probably damaging	Het
Cby2	T	A	14: 75,829,241 (GRCm39)		probably null	Het
Ccdc18	T	C	5: 108,311,640 (GRCm39)		probably null	Het
Cemip	T	A	7: 83,646,433 (GRCm39)	D205V	probably damaging	Het
Cenpn	G	A	8: 117,658,333 (GRCm39)	G93D	probably benign	Het
Clpsl2	T	A	17: 28,768,556 (GRCm39)	S23R	possibly damaging	Het
Cnot3	T	A	7: 3,661,724 (GRCm39)	I672N	possibly damaging	Het
Crygs	A	G	16: 22,625,292 (GRCm39)	Y50H	probably damaging	Het
Cyp4x1	T	C	4: 114,968,874 (GRCm39)	T403A	possibly damaging	Het
Dnajc28	G	A	16: 91,413,795 (GRCm39)	R150*	probably null	Het
Fam184b	C	T	5: 45,741,709 (GRCm39)	G174D	possibly damaging	Het
Fat2	T	A	11: 55,178,638 (GRCm39)	D1474V	probably damaging	Het
Flg2	T	A	3: 93,108,468 (GRCm39)	D165E	possibly damaging	Het
Fpr-rs7	A	T	17: 20,334,443 (GRCm39)	F16I	probably benign	Het
Gpr176	G	A	2: 118,114,615 (GRCm39)	T65I	probably damaging	Het
H2-Q10	C	T	17: 35,781,996 (GRCm39)	T206I	probably null	Het
Hadha	C	G	5: 30,350,285 (GRCm39)	A88P	probably damaging	Het
Hlcs	A	T	16: 94,068,485 (GRCm39)	L245Q	probably damaging	Het
Hnrnph1	T	C	11: 50,270,732 (GRCm39)	V113A	probably damaging	Het
Hsd3b7	G	A	7: 127,401,546 (GRCm39)	V224M	probably damaging	Het
Igha	T	C	12: 113,223,592 (GRCm39)	D88G		Het
Iqca1l	T	C	5: 24,748,608 (GRCm39)	M803V	probably benign	Het
Kdm7a	T	C	6: 39,125,965 (GRCm39)	K610R	probably benign	Het
Krt87	C	T	15: 101,383,284 (GRCm39)	C474Y	probably benign	Het
Lrrc74a	T	A	12: 86,788,530 (GRCm39)	L170H	probably damaging	Het
Lyg2	T	C	1: 37,946,748 (GRCm39)	T178A	probably benign	Het
Map2k2	T	A	10: 80,959,442 (GRCm39)		probably null	Het
Mtmr14	T	A	6: 113,216,529 (GRCm39)	D8E	probably benign	Het
Neu2	C	T	1: 87,524,633 (GRCm39)	P206L	probably damaging	Het
Oga	C	T	19: 45,765,339 (GRCm39)	R156H	probably damaging	Het
Or10al6	A	G	17: 38,083,326 (GRCm39)	T261A	probably benign	Het
Or4c105	A	T	2: 88,647,986 (GRCm39)	Q157L	probably damaging	Het
Poc1b	C	A	10: 98,980,338 (GRCm39)		probably null	Het
Proser1	T	A	3: 53,386,272 (GRCm39)	V718E	possibly damaging	Het
Ptgr2	T	A	12: 84,360,783 (GRCm39)	L351Q	possibly damaging	Het
Ptprf	A	G	4: 118,068,275 (GRCm39)	Y1754H	probably benign	Het
Scgb2b3	T	C	7: 31,058,476 (GRCm39)	K109R	possibly damaging	Het
Scn2a	A	T	2: 65,520,672 (GRCm39)	H556L	probably benign	Het
Scn7a	A	T	2: 66,506,191 (GRCm39)	M1566K	possibly damaging	Het
Slco5a1	A	T	1: 13,060,490 (GRCm39)	L77*	probably null	Het
Stk31	T	C	6: 49,394,261 (GRCm39)	F208L	possibly damaging	Het
Tbcd	C	T	11: 121,384,711 (GRCm39)	T315M	probably benign	Het
Tbx4	A	G	11: 85,801,933 (GRCm39)	I189V	probably benign	Het
Tia1	T	A	6: 86,404,682 (GRCm39)	Y306N	probably benign	Het
Ttc21b	T	A	2: 66,082,500 (GRCm39)	Y33F	probably benign	Het
Usp47	T	A	7: 111,687,133 (GRCm39)	L677*	probably null	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102,907,275 (GRCm39)	nonsense	probably null
IGL00933:Mast4	APN	13	102,871,874 (GRCm39)	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102,910,744 (GRCm39)	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102,890,576 (GRCm39)	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102,897,523 (GRCm39)	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102,904,401 (GRCm39)	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102,887,020 (GRCm39)	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102,874,123 (GRCm39)	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102,873,749 (GRCm39)	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102,910,781 (GRCm39)	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102,874,482 (GRCm39)	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102,878,545 (GRCm39)	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102,872,004 (GRCm39)	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102,990,331 (GRCm39)	makesense	probably null
IGL02850:Mast4	APN	13	102,890,740 (GRCm39)	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102,872,184 (GRCm39)	missense	probably benign
IGL03064:Mast4	APN	13	102,897,472 (GRCm39)	nonsense	probably null
IGL03124:Mast4	APN	13	102,874,753 (GRCm39)	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102,874,163 (GRCm39)	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102,890,764 (GRCm39)	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102,887,905 (GRCm39)	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102,873,615 (GRCm39)	missense	possibly damaging	0.46
buck	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
doe	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
skinnybones	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102,871,370 (GRCm39)	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102,872,825 (GRCm39)	small insertion	probably benign
FR4340:Mast4	UTSW	13	102,871,365 (GRCm39)	frame shift	probably null
FR4548:Mast4	UTSW	13	102,872,826 (GRCm39)	small insertion	probably benign
FR4976:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
FR4976:Mast4	UTSW	13	102,872,820 (GRCm39)	small insertion	probably benign
NA:Mast4	UTSW	13	102,878,565 (GRCm39)	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102,878,566 (GRCm39)	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103,470,723 (GRCm39)	start gained	probably benign
R0242:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102,890,669 (GRCm39)	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102,871,781 (GRCm39)	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102,888,068 (GRCm39)	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102,895,252 (GRCm39)	splice site	probably benign
R0744:Mast4	UTSW	13	102,873,895 (GRCm39)	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102,990,408 (GRCm39)	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102,907,292 (GRCm39)	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102,872,004 (GRCm39)	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102,887,086 (GRCm39)	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102,909,027 (GRCm39)	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102,873,431 (GRCm39)	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102,875,771 (GRCm39)	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102,930,625 (GRCm39)	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102,887,917 (GRCm39)	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102,875,354 (GRCm39)	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102,895,601 (GRCm39)	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102,887,054 (GRCm39)	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102,890,713 (GRCm39)	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102,871,983 (GRCm39)	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102,872,259 (GRCm39)	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102,934,715 (GRCm39)	splice site	probably benign
R2370:Mast4	UTSW	13	102,910,695 (GRCm39)	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102,875,147 (GRCm39)	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102,872,939 (GRCm39)	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102,990,434 (GRCm39)	splice site	probably benign
R3434:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102,923,927 (GRCm39)	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4021:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4022:Mast4	UTSW	13	102,990,377 (GRCm39)	missense	probably damaging	1.00
R4022:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4210:Mast4	UTSW	13	102,875,713 (GRCm39)	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102,910,756 (GRCm39)	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102,873,766 (GRCm39)	nonsense	probably null
R4627:Mast4	UTSW	13	103,470,529 (GRCm39)	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103,470,627 (GRCm39)	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102,910,692 (GRCm39)	critical splice donor site	probably null
R4995:Mast4	UTSW	13	103,042,262 (GRCm39)	intron	probably benign
R5059:Mast4	UTSW	13	102,887,071 (GRCm39)	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102,875,391 (GRCm39)	nonsense	probably null
R5101:Mast4	UTSW	13	102,872,864 (GRCm39)	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102,890,723 (GRCm39)	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102,873,987 (GRCm39)	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102,930,580 (GRCm39)	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102,910,701 (GRCm39)	nonsense	probably null
R5906:Mast4	UTSW	13	102,872,252 (GRCm39)	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102,874,764 (GRCm39)	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102,872,148 (GRCm39)	missense	probably benign
R5987:Mast4	UTSW	13	102,895,242 (GRCm39)	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102,990,391 (GRCm39)	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102,872,717 (GRCm39)	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102,897,890 (GRCm39)	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102,872,493 (GRCm39)	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102,874,004 (GRCm39)	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102,941,222 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,934,586 (GRCm39)	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102,872,482 (GRCm39)	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102,874,223 (GRCm39)	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103,470,508 (GRCm39)	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102,874,986 (GRCm39)	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102,930,511 (GRCm39)	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102,887,932 (GRCm39)	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102,923,934 (GRCm39)	nonsense	probably null
R7697:Mast4	UTSW	13	102,875,711 (GRCm39)	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102,890,596 (GRCm39)	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102,875,783 (GRCm39)	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102,874,184 (GRCm39)	missense	possibly damaging	0.89
R8206:Mast4	UTSW	13	102,872,247 (GRCm39)	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102,875,229 (GRCm39)	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102,887,986 (GRCm39)	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102,897,900 (GRCm39)	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102,919,899 (GRCm39)	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102,895,174 (GRCm39)	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102,934,606 (GRCm39)	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103,470,438 (GRCm39)	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102,887,933 (GRCm39)	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102,925,532 (GRCm39)	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102,872,944 (GRCm39)	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102,873,593 (GRCm39)	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102,910,711 (GRCm39)	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF015:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
RF019:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF037:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF039:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF040:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
Z1088:Mast4	UTSW	13	102,875,027 (GRCm39)	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102,874,968 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCATATGGGAGTCAGGCAAG -3'
(R):5'- TGCTGTTGGTAATCAGGTCC -3'

Sequencing Primer
(F):5'- GCTATAACCCAAGACCAGTGATGTTC -3'
(R):5'- AATCAGGTCCTGGTGATTGGGC -3'

Posted On

2020-07-13