Incidental Mutation 'R8172:Mast4'
ID634206
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R8172 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 102953125 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000164111] [ENSMUST00000166336] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000172264]
Predicted Effect probably null
Transcript: ENSMUST00000099202
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164111
SMART Domains Protein: ENSMUSP00000126625
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166336
SMART Domains Protein: ENSMUSP00000126516
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 71 212 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167058
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172264
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194446
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,543,610 M803V probably benign Het
Adcy5 T A 16: 35,157,057 L320Q probably damaging Het
Adgre4 A T 17: 55,797,769 L278F probably benign Het
Agfg2 C A 5: 137,667,169 R108L probably damaging Het
Arap2 A T 5: 62,621,981 probably null Het
Ascl2 G T 7: 142,968,599 N37K possibly damaging Het
Baiap3 C A 17: 25,244,122 D1043Y probably damaging Het
Ccdc18 T C 5: 108,163,774 probably null Het
Cemip T A 7: 83,997,225 D205V probably damaging Het
Cenpn G A 8: 116,931,594 G93D probably benign Het
Clpsl2 T A 17: 28,549,582 S23R possibly damaging Het
Cnot3 T A 7: 3,658,725 I672N possibly damaging Het
Crygs A G 16: 22,806,542 Y50H probably damaging Het
Cyp4x1 T C 4: 115,111,677 T403A possibly damaging Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Fam184b C T 5: 45,584,367 G174D possibly damaging Het
Fat2 T A 11: 55,287,812 D1474V probably damaging Het
Flg2 T A 3: 93,201,161 D165E possibly damaging Het
Fpr-rs7 A T 17: 20,114,181 F16I probably benign Het
Gpr176 G A 2: 118,284,134 T65I probably damaging Het
H2-Q10 C T 17: 35,471,099 T206I probably null Het
Hadha C G 5: 30,145,287 A88P probably damaging Het
Hlcs A T 16: 94,267,626 L245Q probably damaging Het
Hnrnph1 T C 11: 50,379,905 V113A probably damaging Het
Hsd3b7 G A 7: 127,802,374 V224M probably damaging Het
Igha T C 12: 113,259,972 D88G Het
Kdm7a T C 6: 39,149,031 K610R probably benign Het
Krt83 C T 15: 101,485,403 C474Y probably benign Het
Lrrc74a T A 12: 86,741,756 L170H probably damaging Het
Lyg2 T C 1: 37,907,667 T178A probably benign Het
Map2k2 T A 10: 81,123,608 probably null Het
Mgea5 C T 19: 45,776,900 R156H probably damaging Het
Mtmr14 T A 6: 113,239,568 D8E probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr1202 A T 2: 88,817,642 Q157L probably damaging Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Poc1b C A 10: 99,144,476 probably null Het
Proser1 T A 3: 53,478,851 V718E possibly damaging Het
Ptgr2 T A 12: 84,314,009 L351Q possibly damaging Het
Ptprf A G 4: 118,211,078 Y1754H probably benign Het
Scgb2b3 T C 7: 31,359,051 K109R possibly damaging Het
Scn2a1 A T 2: 65,690,328 H556L probably benign Het
Scn7a A T 2: 66,675,847 M1566K possibly damaging Het
Slco5a1 A T 1: 12,990,266 L77* probably null Het
Spert T A 14: 75,591,801 probably null Het
Stk31 T C 6: 49,417,327 F208L possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Tbx4 A G 11: 85,911,107 I189V probably benign Het
Tia1 T A 6: 86,427,700 Y306N probably benign Het
Ttc21b T A 2: 66,252,156 Y33F probably benign Het
Usp47 T A 7: 112,087,926 L677* probably null Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCATATGGGAGTCAGGCAAG -3'
(R):5'- TGCTGTTGGTAATCAGGTCC -3'

Sequencing Primer
(F):5'- GCTATAACCCAAGACCAGTGATGTTC -3'
(R):5'- AATCAGGTCCTGGTGATTGGGC -3'
Posted On2020-07-13