Incidental Mutation 'R8172:Krt83'
ID634207
Institutional Source Beutler Lab
Gene Symbol Krt83
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 83
SynonymsKrt2-25
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8172 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101431490-101438804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101485403 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 474 (C474Y)
Ref Sequence ENSEMBL: ENSMUSP00000023718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023718]
Predicted Effect probably benign
Transcript: ENSMUST00000023718
AA Change: C474Y

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023718
Gene: ENSMUSG00000067613
AA Change: C474Y

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 100 5.9e-16 PFAM
Filament 103 414 7.02e-149 SMART
low complexity region 422 436 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,543,610 M803V probably benign Het
Adcy5 T A 16: 35,157,057 L320Q probably damaging Het
Adgre4 A T 17: 55,797,769 L278F probably benign Het
Agfg2 C A 5: 137,667,169 R108L probably damaging Het
Arap2 A T 5: 62,621,981 probably null Het
Ascl2 G T 7: 142,968,599 N37K possibly damaging Het
Baiap3 C A 17: 25,244,122 D1043Y probably damaging Het
Ccdc18 T C 5: 108,163,774 probably null Het
Cemip T A 7: 83,997,225 D205V probably damaging Het
Cenpn G A 8: 116,931,594 G93D probably benign Het
Clpsl2 T A 17: 28,549,582 S23R possibly damaging Het
Cnot3 T A 7: 3,658,725 I672N possibly damaging Het
Crygs A G 16: 22,806,542 Y50H probably damaging Het
Cyp4x1 T C 4: 115,111,677 T403A possibly damaging Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Fam184b C T 5: 45,584,367 G174D possibly damaging Het
Fat2 T A 11: 55,287,812 D1474V probably damaging Het
Flg2 T A 3: 93,201,161 D165E possibly damaging Het
Fpr-rs7 A T 17: 20,114,181 F16I probably benign Het
Gpr176 G A 2: 118,284,134 T65I probably damaging Het
H2-Q10 C T 17: 35,471,099 T206I probably null Het
Hadha C G 5: 30,145,287 A88P probably damaging Het
Hlcs A T 16: 94,267,626 L245Q probably damaging Het
Hnrnph1 T C 11: 50,379,905 V113A probably damaging Het
Hsd3b7 G A 7: 127,802,374 V224M probably damaging Het
Igha T C 12: 113,259,972 D88G Het
Kdm7a T C 6: 39,149,031 K610R probably benign Het
Lrrc74a T A 12: 86,741,756 L170H probably damaging Het
Lyg2 T C 1: 37,907,667 T178A probably benign Het
Map2k2 T A 10: 81,123,608 probably null Het
Mast4 C T 13: 102,953,125 probably null Het
Mgea5 C T 19: 45,776,900 R156H probably damaging Het
Mtmr14 T A 6: 113,239,568 D8E probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr1202 A T 2: 88,817,642 Q157L probably damaging Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Poc1b C A 10: 99,144,476 probably null Het
Proser1 T A 3: 53,478,851 V718E possibly damaging Het
Ptgr2 T A 12: 84,314,009 L351Q possibly damaging Het
Ptprf A G 4: 118,211,078 Y1754H probably benign Het
Scgb2b3 T C 7: 31,359,051 K109R possibly damaging Het
Scn2a1 A T 2: 65,690,328 H556L probably benign Het
Scn7a A T 2: 66,675,847 M1566K possibly damaging Het
Slco5a1 A T 1: 12,990,266 L77* probably null Het
Spert T A 14: 75,591,801 probably null Het
Stk31 T C 6: 49,417,327 F208L possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Tbx4 A G 11: 85,911,107 I189V probably benign Het
Tia1 T A 6: 86,427,700 Y306N probably benign Het
Ttc21b T A 2: 66,252,156 Y33F probably benign Het
Usp47 T A 7: 112,087,926 L677* probably null Het
Other mutations in Krt83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Krt83 APN 15 101488211 missense probably benign 0.17
IGL01315:Krt83 APN 15 101486967 splice site probably benign
IGL01702:Krt83 APN 15 101491218 missense probably benign 0.18
IGL02123:Krt83 APN 15 101487585 missense possibly damaging 0.49
IGL02353:Krt83 APN 15 101485458 missense probably benign
IGL02360:Krt83 APN 15 101485458 missense probably benign
IGL02395:Krt83 APN 15 101487952 missense probably benign 0.18
IGL02633:Krt83 APN 15 101491214 missense probably damaging 1.00
R0357:Krt83 UTSW 15 101487019 missense probably benign 0.17
R0650:Krt83 UTSW 15 101487040 missense probably damaging 0.99
R0928:Krt83 UTSW 15 101491280 missense probably benign 0.00
R1126:Krt83 UTSW 15 101487482 missense probably damaging 0.98
R1196:Krt83 UTSW 15 101491433 missense probably benign 0.03
R1252:Krt83 UTSW 15 101487830 missense probably damaging 1.00
R1513:Krt83 UTSW 15 101489657 missense probably benign 0.30
R1612:Krt83 UTSW 15 101488211 missense probably benign 0.17
R1870:Krt83 UTSW 15 101487190 missense probably benign
R2173:Krt83 UTSW 15 101487937 missense probably damaging 0.98
R2432:Krt83 UTSW 15 101488156 nonsense probably null
R2568:Krt83 UTSW 15 101487827 missense possibly damaging 0.67
R2696:Krt83 UTSW 15 101487009 missense probably benign 0.01
R3508:Krt83 UTSW 15 101488158 missense probably benign 0.04
R4364:Krt83 UTSW 15 101487514 missense probably benign
R4366:Krt83 UTSW 15 101487514 missense probably benign
R4606:Krt83 UTSW 15 101487049 missense probably benign 0.18
R4721:Krt83 UTSW 15 101487982 missense probably damaging 1.00
R4784:Krt83 UTSW 15 101487956 missense probably damaging 1.00
R4987:Krt83 UTSW 15 101487009 missense probably benign
R5008:Krt83 UTSW 15 101491224 missense probably damaging 1.00
R5101:Krt83 UTSW 15 101487510 missense probably benign 0.14
R5367:Krt83 UTSW 15 101486994 missense probably damaging 1.00
R5516:Krt83 UTSW 15 101487121 nonsense probably null
R5949:Krt83 UTSW 15 101487595 missense probably damaging 0.99
R5972:Krt83 UTSW 15 101487586 missense probably benign
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6135:Krt83 UTSW 15 101487534 missense probably damaging 1.00
R7151:Krt83 UTSW 15 101489648 missense probably damaging 1.00
R7186:Krt83 UTSW 15 101487202 splice site probably null
R7297:Krt83 UTSW 15 101489647 missense probably benign 0.42
R7708:Krt83 UTSW 15 101487932 missense probably benign 0.00
R7796:Krt83 UTSW 15 101485984 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGAAACAGCACTGGGTATTCC -3'
(R):5'- TCAAGACTGACCCTGCCTTTG -3'

Sequencing Primer
(F):5'- TATTCCCAGGGCTGCAGCTG -3'
(R):5'- GTTCTCACAGGTGTCAGCAG -3'
Posted On2020-07-13