Incidental Mutation 'R8172:Fpr-rs7'
ID 634213
Institutional Source Beutler Lab
Gene Symbol Fpr-rs7
Ensembl Gene ENSMUSG00000071276
Gene Name formyl peptide receptor, related sequence 7
Synonyms
MMRRC Submission 067598-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8172 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20333472-20334488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20334443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 16 (F16I)
Ref Sequence ENSEMBL: ENSMUSP00000093297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095637]
AlphaFold Q71MR7
Predicted Effect probably benign
Transcript: ENSMUST00000095637
AA Change: F16I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093297
Gene: ENSMUSG00000071276
AA Change: F16I

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 1.2e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T A 16: 34,977,427 (GRCm39) L320Q probably damaging Het
Adgre4 A T 17: 56,104,769 (GRCm39) L278F probably benign Het
Agfg2 C A 5: 137,665,431 (GRCm39) R108L probably damaging Het
Arap2 A T 5: 62,779,324 (GRCm39) probably null Het
Ascl2 G T 7: 142,522,336 (GRCm39) N37K possibly damaging Het
Baiap3 C A 17: 25,463,096 (GRCm39) D1043Y probably damaging Het
Cby2 T A 14: 75,829,241 (GRCm39) probably null Het
Ccdc18 T C 5: 108,311,640 (GRCm39) probably null Het
Cemip T A 7: 83,646,433 (GRCm39) D205V probably damaging Het
Cenpn G A 8: 117,658,333 (GRCm39) G93D probably benign Het
Clpsl2 T A 17: 28,768,556 (GRCm39) S23R possibly damaging Het
Cnot3 T A 7: 3,661,724 (GRCm39) I672N possibly damaging Het
Crygs A G 16: 22,625,292 (GRCm39) Y50H probably damaging Het
Cyp4x1 T C 4: 114,968,874 (GRCm39) T403A possibly damaging Het
Dnajc28 G A 16: 91,413,795 (GRCm39) R150* probably null Het
Fam184b C T 5: 45,741,709 (GRCm39) G174D possibly damaging Het
Fat2 T A 11: 55,178,638 (GRCm39) D1474V probably damaging Het
Flg2 T A 3: 93,108,468 (GRCm39) D165E possibly damaging Het
Gpr176 G A 2: 118,114,615 (GRCm39) T65I probably damaging Het
H2-Q10 C T 17: 35,781,996 (GRCm39) T206I probably null Het
Hadha C G 5: 30,350,285 (GRCm39) A88P probably damaging Het
Hlcs A T 16: 94,068,485 (GRCm39) L245Q probably damaging Het
Hnrnph1 T C 11: 50,270,732 (GRCm39) V113A probably damaging Het
Hsd3b7 G A 7: 127,401,546 (GRCm39) V224M probably damaging Het
Igha T C 12: 113,223,592 (GRCm39) D88G Het
Iqca1l T C 5: 24,748,608 (GRCm39) M803V probably benign Het
Kdm7a T C 6: 39,125,965 (GRCm39) K610R probably benign Het
Krt87 C T 15: 101,383,284 (GRCm39) C474Y probably benign Het
Lrrc74a T A 12: 86,788,530 (GRCm39) L170H probably damaging Het
Lyg2 T C 1: 37,946,748 (GRCm39) T178A probably benign Het
Map2k2 T A 10: 80,959,442 (GRCm39) probably null Het
Mast4 C T 13: 103,089,633 (GRCm39) probably null Het
Mtmr14 T A 6: 113,216,529 (GRCm39) D8E probably benign Het
Neu2 C T 1: 87,524,633 (GRCm39) P206L probably damaging Het
Oga C T 19: 45,765,339 (GRCm39) R156H probably damaging Het
Or10al6 A G 17: 38,083,326 (GRCm39) T261A probably benign Het
Or4c105 A T 2: 88,647,986 (GRCm39) Q157L probably damaging Het
Poc1b C A 10: 98,980,338 (GRCm39) probably null Het
Proser1 T A 3: 53,386,272 (GRCm39) V718E possibly damaging Het
Ptgr2 T A 12: 84,360,783 (GRCm39) L351Q possibly damaging Het
Ptprf A G 4: 118,068,275 (GRCm39) Y1754H probably benign Het
Scgb2b3 T C 7: 31,058,476 (GRCm39) K109R possibly damaging Het
Scn2a A T 2: 65,520,672 (GRCm39) H556L probably benign Het
Scn7a A T 2: 66,506,191 (GRCm39) M1566K possibly damaging Het
Slco5a1 A T 1: 13,060,490 (GRCm39) L77* probably null Het
Stk31 T C 6: 49,394,261 (GRCm39) F208L possibly damaging Het
Tbcd C T 11: 121,384,711 (GRCm39) T315M probably benign Het
Tbx4 A G 11: 85,801,933 (GRCm39) I189V probably benign Het
Tia1 T A 6: 86,404,682 (GRCm39) Y306N probably benign Het
Ttc21b T A 2: 66,082,500 (GRCm39) Y33F probably benign Het
Usp47 T A 7: 111,687,133 (GRCm39) L677* probably null Het
Other mutations in Fpr-rs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fpr-rs7 APN 17 20,333,480 (GRCm39) nonsense probably null
IGL01386:Fpr-rs7 APN 17 20,334,454 (GRCm39) missense probably damaging 0.98
IGL02293:Fpr-rs7 APN 17 20,334,232 (GRCm39) missense probably benign 0.01
IGL03303:Fpr-rs7 APN 17 20,334,001 (GRCm39) missense possibly damaging 0.55
R0731:Fpr-rs7 UTSW 17 20,334,116 (GRCm39) missense probably benign 0.00
R0826:Fpr-rs7 UTSW 17 20,333,888 (GRCm39) missense probably benign 0.01
R1439:Fpr-rs7 UTSW 17 20,333,869 (GRCm39) missense probably benign 0.10
R1590:Fpr-rs7 UTSW 17 20,333,678 (GRCm39) missense probably benign 0.05
R1778:Fpr-rs7 UTSW 17 20,334,277 (GRCm39) missense probably damaging 1.00
R4715:Fpr-rs7 UTSW 17 20,333,690 (GRCm39) missense probably benign 0.00
R4744:Fpr-rs7 UTSW 17 20,334,265 (GRCm39) missense probably benign 0.17
R4921:Fpr-rs7 UTSW 17 20,334,082 (GRCm39) missense possibly damaging 0.70
R5540:Fpr-rs7 UTSW 17 20,334,356 (GRCm39) missense probably damaging 1.00
R5677:Fpr-rs7 UTSW 17 20,334,365 (GRCm39) missense probably benign
R5959:Fpr-rs7 UTSW 17 20,334,011 (GRCm39) missense probably benign 0.01
R6042:Fpr-rs7 UTSW 17 20,333,477 (GRCm39) missense probably benign 0.00
R7921:Fpr-rs7 UTSW 17 20,333,667 (GRCm39) missense probably benign 0.03
R7984:Fpr-rs7 UTSW 17 20,333,671 (GRCm39) missense probably benign 0.01
R8137:Fpr-rs7 UTSW 17 20,334,055 (GRCm39) missense possibly damaging 0.49
R8762:Fpr-rs7 UTSW 17 20,333,789 (GRCm39) missense probably benign 0.07
R9134:Fpr-rs7 UTSW 17 20,334,325 (GRCm39) missense probably damaging 1.00
Z1176:Fpr-rs7 UTSW 17 20,333,655 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGACAATGCCAGGTTCAG -3'
(R):5'- TGCAAGGTCATGGGAGATTATG -3'

Sequencing Primer
(F):5'- GCCAGGTTCAGATAACAGATTGTTG -3'
(R):5'- GTCATGGGAGATTATGACTCATTTC -3'
Posted On 2020-07-13