Incidental Mutation 'R8172:H2-Q10'
ID634216
Institutional Source Beutler Lab
Gene Symbol H2-Q10
Ensembl Gene ENSMUSG00000067235
Gene Namehistocompatibility 2, Q region locus 10
SynonymsH-2Q10, Qa10, Q10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8172 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35470089-35474563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35471099 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 206 (T206I)
Ref Sequence ENSEMBL: ENSMUSP00000066419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068291] [ENSMUST00000174525]
Predicted Effect probably null
Transcript: ENSMUST00000068291
AA Change: T206I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066419
Gene: ENSMUSG00000067235
AA Change: T206I

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.8e-98 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174525
AA Change: T206I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134163
Gene: ENSMUSG00000067235
AA Change: T206I

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 3.3e-99 PFAM
IGc1 222 293 8.23e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Unlike other class I genes, this gene is expressed only in liver cells and its product is secreted into the serum. The amount of protein in serum varies among inbred strains with different H2 haplotypes and is completely absent in the H2f strain B10.M. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,543,610 M803V probably benign Het
Adcy5 T A 16: 35,157,057 L320Q probably damaging Het
Adgre4 A T 17: 55,797,769 L278F probably benign Het
Agfg2 C A 5: 137,667,169 R108L probably damaging Het
Arap2 A T 5: 62,621,981 probably null Het
Ascl2 G T 7: 142,968,599 N37K possibly damaging Het
Baiap3 C A 17: 25,244,122 D1043Y probably damaging Het
Ccdc18 T C 5: 108,163,774 probably null Het
Cemip T A 7: 83,997,225 D205V probably damaging Het
Cenpn G A 8: 116,931,594 G93D probably benign Het
Clpsl2 T A 17: 28,549,582 S23R possibly damaging Het
Cnot3 T A 7: 3,658,725 I672N possibly damaging Het
Crygs A G 16: 22,806,542 Y50H probably damaging Het
Cyp4x1 T C 4: 115,111,677 T403A possibly damaging Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Fam184b C T 5: 45,584,367 G174D possibly damaging Het
Fat2 T A 11: 55,287,812 D1474V probably damaging Het
Flg2 T A 3: 93,201,161 D165E possibly damaging Het
Fpr-rs7 A T 17: 20,114,181 F16I probably benign Het
Gpr176 G A 2: 118,284,134 T65I probably damaging Het
Hadha C G 5: 30,145,287 A88P probably damaging Het
Hlcs A T 16: 94,267,626 L245Q probably damaging Het
Hnrnph1 T C 11: 50,379,905 V113A probably damaging Het
Hsd3b7 G A 7: 127,802,374 V224M probably damaging Het
Igha T C 12: 113,259,972 D88G Het
Kdm7a T C 6: 39,149,031 K610R probably benign Het
Krt83 C T 15: 101,485,403 C474Y probably benign Het
Lrrc74a T A 12: 86,741,756 L170H probably damaging Het
Lyg2 T C 1: 37,907,667 T178A probably benign Het
Map2k2 T A 10: 81,123,608 probably null Het
Mast4 C T 13: 102,953,125 probably null Het
Mgea5 C T 19: 45,776,900 R156H probably damaging Het
Mtmr14 T A 6: 113,239,568 D8E probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr1202 A T 2: 88,817,642 Q157L probably damaging Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Poc1b C A 10: 99,144,476 probably null Het
Proser1 T A 3: 53,478,851 V718E possibly damaging Het
Ptgr2 T A 12: 84,314,009 L351Q possibly damaging Het
Ptprf A G 4: 118,211,078 Y1754H probably benign Het
Scgb2b3 T C 7: 31,359,051 K109R possibly damaging Het
Scn2a1 A T 2: 65,690,328 H556L probably benign Het
Scn7a A T 2: 66,675,847 M1566K possibly damaging Het
Slco5a1 A T 1: 12,990,266 L77* probably null Het
Spert T A 14: 75,591,801 probably null Het
Stk31 T C 6: 49,417,327 F208L possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Tbx4 A G 11: 85,911,107 I189V probably benign Het
Tia1 T A 6: 86,427,700 Y306N probably benign Het
Ttc21b T A 2: 66,252,156 Y33F probably benign Het
Usp47 T A 7: 112,087,926 L677* probably null Het
Other mutations in H2-Q10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:H2-Q10 APN 17 35473271 missense probably damaging 1.00
IGL02003:H2-Q10 APN 17 35470441 missense probably benign 0.01
IGL02308:H2-Q10 APN 17 35473566 makesense probably null
IGL02804:H2-Q10 APN 17 35473250 missense probably damaging 1.00
gomez UTSW 17 35474020 utr 3 prime probably benign
lurch UTSW 17 35471018 missense possibly damaging 0.92
R0278:H2-Q10 UTSW 17 35473307 missense possibly damaging 0.83
R1679:H2-Q10 UTSW 17 35473595 utr 3 prime probably benign
R1919:H2-Q10 UTSW 17 35470488 missense probably damaging 1.00
R3781:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R3782:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R4614:H2-Q10 UTSW 17 35474020 utr 3 prime probably benign
R4814:H2-Q10 UTSW 17 35473584 utr 3 prime probably benign
R4870:H2-Q10 UTSW 17 35470460 missense probably damaging 1.00
R6063:H2-Q10 UTSW 17 35470129 missense probably benign 0.13
R7448:H2-Q10 UTSW 17 35473560 missense not run
R7728:H2-Q10 UTSW 17 35470838 missense probably damaging 0.98
R8034:H2-Q10 UTSW 17 35470441 missense probably damaging 1.00
R8233:H2-Q10 UTSW 17 35471086 missense probably benign 0.28
R8400:H2-Q10 UTSW 17 35470477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCCTGAACGAAGACCTG -3'
(R):5'- GTTGTTACCTCAGGGAAATTCTC -3'

Sequencing Primer
(F):5'- CCTGAAAACGTGGACGGC -3'
(R):5'- CACTGTCCAGGGAGAAGGCTG -3'
Posted On2020-07-13