Incidental Mutation 'R8172:Mgea5'
ID 634219
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Name meningioma expressed antigen 5 (hyaluronidase)
Synonyms 2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8172 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 45750261-45783520 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45776900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 156 (R156H)
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
AlphaFold Q9EQQ9
Predicted Effect probably damaging
Transcript: ENSMUST00000026243
AA Change: R156H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: R156H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,543,610 M803V probably benign Het
Adcy5 T A 16: 35,157,057 L320Q probably damaging Het
Adgre4 A T 17: 55,797,769 L278F probably benign Het
Agfg2 C A 5: 137,667,169 R108L probably damaging Het
Arap2 A T 5: 62,621,981 probably null Het
Ascl2 G T 7: 142,968,599 N37K possibly damaging Het
Baiap3 C A 17: 25,244,122 D1043Y probably damaging Het
Ccdc18 T C 5: 108,163,774 probably null Het
Cemip T A 7: 83,997,225 D205V probably damaging Het
Cenpn G A 8: 116,931,594 G93D probably benign Het
Clpsl2 T A 17: 28,549,582 S23R possibly damaging Het
Cnot3 T A 7: 3,658,725 I672N possibly damaging Het
Crygs A G 16: 22,806,542 Y50H probably damaging Het
Cyp4x1 T C 4: 115,111,677 T403A possibly damaging Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Fam184b C T 5: 45,584,367 G174D possibly damaging Het
Fat2 T A 11: 55,287,812 D1474V probably damaging Het
Flg2 T A 3: 93,201,161 D165E possibly damaging Het
Fpr-rs7 A T 17: 20,114,181 F16I probably benign Het
Gpr176 G A 2: 118,284,134 T65I probably damaging Het
H2-Q10 C T 17: 35,471,099 T206I probably null Het
Hadha C G 5: 30,145,287 A88P probably damaging Het
Hlcs A T 16: 94,267,626 L245Q probably damaging Het
Hnrnph1 T C 11: 50,379,905 V113A probably damaging Het
Hsd3b7 G A 7: 127,802,374 V224M probably damaging Het
Igha T C 12: 113,259,972 D88G Het
Kdm7a T C 6: 39,149,031 K610R probably benign Het
Krt83 C T 15: 101,485,403 C474Y probably benign Het
Lrrc74a T A 12: 86,741,756 L170H probably damaging Het
Lyg2 T C 1: 37,907,667 T178A probably benign Het
Map2k2 T A 10: 81,123,608 probably null Het
Mast4 C T 13: 102,953,125 probably null Het
Mtmr14 T A 6: 113,239,568 D8E probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr1202 A T 2: 88,817,642 Q157L probably damaging Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Poc1b C A 10: 99,144,476 probably null Het
Proser1 T A 3: 53,478,851 V718E possibly damaging Het
Ptgr2 T A 12: 84,314,009 L351Q possibly damaging Het
Ptprf A G 4: 118,211,078 Y1754H probably benign Het
Scgb2b3 T C 7: 31,359,051 K109R possibly damaging Het
Scn2a1 A T 2: 65,690,328 H556L probably benign Het
Scn7a A T 2: 66,675,847 M1566K possibly damaging Het
Slco5a1 A T 1: 12,990,266 L77* probably null Het
Spert T A 14: 75,591,801 probably null Het
Stk31 T C 6: 49,417,327 F208L possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Tbx4 A G 11: 85,911,107 I189V probably benign Het
Tia1 T A 6: 86,427,700 Y306N probably benign Het
Ttc21b T A 2: 66,252,156 Y33F probably benign Het
Usp47 T A 7: 112,087,926 L677* probably null Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R0863:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5377:Mgea5 UTSW 19 45758022 nonsense probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6410:Mgea5 UTSW 19 45776045 splice site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
R7340:Mgea5 UTSW 19 45767456 nonsense probably null
R7437:Mgea5 UTSW 19 45778607 missense possibly damaging 0.76
R7490:Mgea5 UTSW 19 45767447 nonsense probably null
R7741:Mgea5 UTSW 19 45776062 missense probably damaging 1.00
R7823:Mgea5 UTSW 19 45776915 missense possibly damaging 0.51
R8017:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8019:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8066:Mgea5 UTSW 19 45771852 missense probably damaging 0.99
R8075:Mgea5 UTSW 19 45761182 missense probably damaging 0.97
R8558:Mgea5 UTSW 19 45758072 missense probably benign 0.00
R9050:Mgea5 UTSW 19 45767915 missense probably damaging 1.00
R9150:Mgea5 UTSW 19 45782982 missense probably benign 0.00
R9404:Mgea5 UTSW 19 45754657 frame shift probably null
R9562:Mgea5 UTSW 19 45754657 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTATACAAGGCAGCAAATCAATGAG -3'
(R):5'- TGACTTCTTCCGTTACAAAGTAAAG -3'

Sequencing Primer
(F):5'- CAGTGGACTTCTGAATTCAAGGCC -3'
(R):5'- AAAGTTTGTTTTAGTGTTCCTGTTGC -3'
Posted On 2020-07-13