Incidental Mutation 'R8174:Olfr1445'
ID634259
Institutional Source Beutler Lab
Gene Symbol Olfr1445
Ensembl Gene ENSMUSG00000045126
Gene Nameolfactory receptor 1445
SynonymsGA_x6K02T2RE5P-3213352-3214296, MOR202-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R8174 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12883855-12884855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12883904 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000058933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049624]
Predicted Effect probably benign
Transcript: ENSMUST00000049624
AA Change: T8A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058933
Gene: ENSMUSG00000045126
AA Change: T8A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-54 PFAM
Pfam:7tm_1 39 288 4.6e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik T G 1: 85,099,540 S102R probably damaging Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Asxl3 T C 18: 22,517,743 S930P probably benign Het
Cachd1 T A 4: 100,966,269 I506N probably damaging Het
Calm1 G T 12: 100,205,708 V140L probably benign Het
Cdsn A T 17: 35,555,632 K353* probably null Het
Cldn11 T C 3: 31,154,061 V125A probably benign Het
Ddx60 G A 8: 62,017,250 probably null Het
Dlg2 A G 7: 91,940,040 I216V probably benign Het
Dnah5 A G 15: 28,311,133 probably null Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Erap1 A T 13: 74,646,564 Y114F probably benign Het
Fam179b G T 12: 64,982,691 D963Y possibly damaging Het
Gm14443 G A 2: 175,169,675 P326L probably damaging Het
Gm2042 T A 12: 87,960,158 L415Q probably damaging Het
Gm8797 T C 3: 5,751,034 I44T probably benign Het
Matn2 C A 15: 34,422,409 F547L probably benign Het
Mpc2 T A 1: 165,480,889 probably null Het
Olfr77 A C 9: 19,920,724 T172P probably damaging Het
Pcnx4 T A 12: 72,556,913 L536Q probably damaging Het
Phlpp2 G A 8: 109,868,689 R24H unknown Het
Pkmyt1 A T 17: 23,733,839 D123V probably damaging Het
Polg A T 7: 79,456,718 M668K probably benign Het
Ppp1r12a G T 10: 108,271,737 A974S probably benign Het
Ppp2r3a T C 9: 101,213,302 probably benign Het
Rabl3 T C 16: 37,556,863 Y61H probably damaging Het
Rap2a T A 14: 120,478,857 I44N probably damaging Het
Rev3l T C 10: 39,859,115 V2779A probably damaging Het
Rnf43 G T 11: 87,731,231 R259L probably benign Het
Rspry1 T A 8: 94,649,822 L448Q probably damaging Het
Slc43a2 T G 11: 75,543,367 probably null Het
Slc6a5 A G 7: 49,948,309 I640M probably benign Het
Srrm2 C T 17: 23,815,323 P314S unknown Het
Strn4 C T 7: 16,828,808 R291C probably damaging Het
Syt4 T A 18: 31,444,177 R41S probably benign Het
Tfb1m T C 17: 3,519,580 D337G probably benign Het
Tpsg1 T C 17: 25,372,590 C55R probably damaging Het
Tram1l1 A G 3: 124,322,262 K357R probably benign Het
Veph1 A G 3: 66,263,895 I42T probably damaging Het
Vps13b C G 15: 35,709,310 S1801* probably null Het
Zcwpw1 G A 5: 137,819,577 probably null Het
Zfp266 G A 9: 20,506,814 probably benign Het
Zmym5 T A 14: 56,794,461 R397* probably null Het
Other mutations in Olfr1445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr1445 APN 19 12883901 missense probably benign 0.03
IGL01786:Olfr1445 APN 19 12884277 missense probably damaging 0.99
IGL02375:Olfr1445 APN 19 12883941 missense probably benign 0.00
IGL03220:Olfr1445 APN 19 12884451 missense possibly damaging 0.80
IGL03232:Olfr1445 APN 19 12884272 nonsense probably null
R0505:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0505:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R0541:Olfr1445 UTSW 19 12884094 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R2187:Olfr1445 UTSW 19 12884255 missense probably damaging 1.00
R2231:Olfr1445 UTSW 19 12883949 missense probably benign 0.00
R3706:Olfr1445 UTSW 19 12883896 missense probably damaging 1.00
R4698:Olfr1445 UTSW 19 12884621 missense probably benign 0.08
R5558:Olfr1445 UTSW 19 12884387 missense probably benign 0.01
R6163:Olfr1445 UTSW 19 12884108 missense probably damaging 1.00
R7057:Olfr1445 UTSW 19 12884642 missense probably damaging 0.98
R7063:Olfr1445 UTSW 19 12884085 missense probably damaging 1.00
R7705:Olfr1445 UTSW 19 12884507 missense probably benign 0.01
R8073:Olfr1445 UTSW 19 12884616 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTGAATTTTGCTGCCTC -3'
(R):5'- TTTGGGAGTGACAGCTGAAG -3'

Sequencing Primer
(F):5'- CAGTCTGCTTGGATCAGAATGC -3'
(R):5'- GTCCACCAGAGATAGATGACTG -3'
Posted On2020-07-13