Incidental Mutation 'R8175:Ren1'
ID634262
Institutional Source Beutler Lab
Gene Symbol Ren1
Ensembl Gene ENSMUSG00000070645
Gene Namerenin 1 structural
SynonymsRen-1, Ren1d, Ren1c, Ren, Ren-A, Rnr, Rn-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8175 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location133350510-133360325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133354269 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 79 (Y79H)
Ref Sequence ENSEMBL: ENSMUSP00000092135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094556] [ENSMUST00000112287]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094556
AA Change: Y79H

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092135
Gene: ENSMUSG00000070645
AA Change: Y79H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A1_Propeptide 29 54 1.2e-10 PFAM
Pfam:Asp 83 401 1.3e-120 PFAM
Pfam:TAXi_C 261 400 1.4e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112287
AA Change: Y43H

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Renin catalyzes the first step in the activation pathway of angiotensinogen--a cascade that can result in aldosterone release,vasoconstriction, and increase in blood pressure. Renin, an aspartyl protease, cleaves angiotensinogen to form angiotensin I, which is converted to angiotensin II by angiotensin I converting enzyme, an important regulator of blood pressure and electrolyte balance. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause familial hyperproreninemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to postnatal lethality, reduced plasma renin level, decreased mean arterial pressure, and kidney defects such as atrophy, altered juxtaglomerular cell and macula densa morphology, polyuria, decreased urine osmolality, and reduced glomerular filtration rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,164,448 C2548* probably null Het
Adamts15 C T 9: 30,904,656 V635M probably damaging Het
AI314180 C T 4: 58,872,756 V182M probably damaging Het
Aim2 A T 1: 173,455,354 M1L possibly damaging Het
Ank3 T C 10: 69,893,509 V700A unknown Het
Arhgap10 T C 8: 77,310,842 T586A probably benign Het
Arhgef4 G A 1: 34,810,374 V349I probably benign Het
Atp1a1 A G 3: 101,584,854 F569L possibly damaging Het
Btbd10 T A 7: 113,322,792 probably null Het
Capza2 G A 6: 17,665,382 D270N probably benign Het
Cobll1 T C 2: 65,099,231 N584D probably benign Het
Coro1c T A 5: 113,850,815 I156F probably benign Het
Cpsf3 T C 12: 21,300,177 I299T probably benign Het
Cse1l T A 2: 166,943,208 probably null Het
D5Ertd579e T C 5: 36,615,470 E527G probably damaging Het
Dcbld2 T C 16: 58,433,347 L149S possibly damaging Het
Egflam C A 15: 7,212,152 W925L probably damaging Het
Ehmt2 A G 17: 34,911,420 N1071D probably damaging Het
Eif3g A T 9: 20,897,730 S93T probably damaging Het
Eng C A 2: 32,678,922 T487K possibly damaging Het
Epb41l3 T C 17: 69,210,366 Y130H probably damaging Het
F5 A T 1: 164,192,265 R770* probably null Het
Fam227a A G 15: 79,640,660 F201S probably damaging Het
Fam50b G A 13: 34,746,864 E108K probably benign Het
Fam65c T C 2: 167,983,759 S760G probably benign Het
Fn1 A G 1: 71,599,665 I1971T probably damaging Het
Fsip2 T A 2: 82,984,744 F3607Y probably benign Het
Fsip2 A T 2: 82,987,677 I4585L probably benign Het
Gas1 T C 13: 60,176,118 N275S Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hus1b A G 13: 30,947,232 V148A probably benign Het
Ighmbp2 A G 19: 3,266,365 L575P possibly damaging Het
Igsf21 A T 4: 140,028,231 F371Y probably damaging Het
Jade1 G T 3: 41,613,288 R597L probably benign Het
Krt4 A G 15: 101,920,549 probably null Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lifr A G 15: 7,187,015 T824A probably damaging Het
Megf6 T A 4: 154,268,619 C1307* probably null Het
Ndufb10 A T 17: 24,724,192 V48E possibly damaging Het
Nelfa T C 5: 33,922,013 K72R possibly damaging Het
Obscn C T 11: 58,995,960 V7767I unknown Het
Pptc7 T A 5: 122,319,819 C284S probably benign Het
Pxdc1 A G 13: 34,628,815 S218P probably damaging Het
Rabep1 T A 11: 70,884,929 W110R probably damaging Het
Setd1a A G 7: 127,796,243 E1327G unknown Het
Setd5 T C 6: 113,114,913 W232R probably damaging Het
Slf1 A T 13: 77,112,671 H171Q probably damaging Het
Smoc1 A G 12: 81,167,666 D285G probably damaging Het
Ssfa2 A G 2: 79,658,152 R860G probably damaging Het
Taf10 T C 7: 105,743,927 Y97C probably damaging Het
Tgfbr2 G A 9: 116,109,955 S293L possibly damaging Het
Tmem181a A G 17: 6,295,800 I190V probably benign Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tssc1 A G 12: 28,863,107 E269G Het
Ube4b T C 4: 149,351,516 N716D probably benign Het
Unc5d T A 8: 28,844,827 K157N probably damaging Het
Usp19 G A 9: 108,500,178 R1255H probably damaging Het
Vmn2r12 T A 5: 109,090,483 I464F probably damaging Het
Zbtb20 A T 16: 43,577,080 probably benign Het
Zfp790 T G 7: 29,829,780 L630R possibly damaging Het
Other mutations in Ren1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ren1 APN 1 133358412 missense probably benign 0.00
IGL02172:Ren1 APN 1 133359033 missense possibly damaging 0.95
IGL02686:Ren1 APN 1 133358469 missense possibly damaging 0.86
3_musketeers UTSW 1 133354808 missense probably damaging 1.00
snickers UTSW 1 133356518 missense probably damaging 1.00
R0268:Ren1 UTSW 1 133355611 missense possibly damaging 0.74
R1115:Ren1 UTSW 1 133356518 missense probably damaging 1.00
R1728:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1728:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1728:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1728:Ren1 UTSW 1 133358982 splice site probably null
R1728:Ren1 UTSW 1 133359079 missense probably benign
R1728:Ren1 UTSW 1 133359983 missense probably benign
R1728:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1729:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1729:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1729:Ren1 UTSW 1 133359079 missense probably benign
R1729:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1730:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1730:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1730:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1730:Ren1 UTSW 1 133359079 missense probably benign
R1730:Ren1 UTSW 1 133359983 missense probably benign
R1730:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1739:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1739:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1739:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1739:Ren1 UTSW 1 133359079 missense probably benign
R1739:Ren1 UTSW 1 133359983 missense probably benign
R1739:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1762:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1762:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1762:Ren1 UTSW 1 133358982 splice site probably null
R1762:Ren1 UTSW 1 133359079 missense probably benign
R1762:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1783:Ren1 UTSW 1 133350778 splice site probably null
R1783:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1783:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1783:Ren1 UTSW 1 133359079 missense probably benign
R1783:Ren1 UTSW 1 133359983 missense probably benign
R1783:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1784:Ren1 UTSW 1 133350778 splice site probably null
R1784:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1784:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1784:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1784:Ren1 UTSW 1 133359079 missense probably benign
R1784:Ren1 UTSW 1 133359983 missense probably benign
R1784:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1785:Ren1 UTSW 1 133350778 splice site probably null
R1785:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1785:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1785:Ren1 UTSW 1 133359079 missense probably benign
R1785:Ren1 UTSW 1 133359983 missense probably benign
R1785:Ren1 UTSW 1 133360007 missense probably benign 0.02
R2049:Ren1 UTSW 1 133350778 splice site probably null
R2130:Ren1 UTSW 1 133350778 splice site probably null
R2131:Ren1 UTSW 1 133350778 splice site probably null
R2133:Ren1 UTSW 1 133358982 splice site probably null
R2141:Ren1 UTSW 1 133350778 splice site probably null
R2142:Ren1 UTSW 1 133350778 splice site probably null
R2518:Ren1 UTSW 1 133360124 missense probably damaging 1.00
R4361:Ren1 UTSW 1 133359041 missense probably benign
R4584:Ren1 UTSW 1 133354808 missense probably damaging 1.00
R5188:Ren1 UTSW 1 133350613 unclassified probably benign
R5806:Ren1 UTSW 1 133355511 nonsense probably null
R7999:Ren1 UTSW 1 133354866 missense probably damaging 1.00
R8093:Ren1 UTSW 1 133360074 missense probably damaging 1.00
R8259:Ren1 UTSW 1 133350796 nonsense probably null
RF037:Ren1 UTSW 1 133350781 unclassified probably benign
RF044:Ren1 UTSW 1 133350781 unclassified probably benign
Z1177:Ren1 UTSW 1 133350750 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACATTGGAGCACTGCACG -3'
(R):5'- TGGGGCATGGAAGCTTAATC -3'

Sequencing Primer
(F):5'- GAGCACTGCACGACTCTTCTG -3'
(R):5'- CTACAAAGTGAGTTCCAGGCTTGC -3'
Posted On2020-07-13