Mutagenetix > Incidental Mutation

Incidental Mutation 'R8175:Cse1l'

634271

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8175 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 166943208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000002790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109238] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably null
Transcript: ENSMUST00000002790

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000049412

SMART Domains

Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536

Domain	Start	End	E-Value	Type
Blast:DSRM	1	73	5e-21	BLAST
DSRM	97	162	9.49e-21	SMART
DSRM	199	265	5.54e-22	SMART
PDB:4DKK\|A	355	469	2e-69	PDB
Blast:DSRM	401	466	3e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000109235

SMART Domains

Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536

Domain	Start	End	E-Value	Type
Blast:DSRM	1	73	5e-21	BLAST
DSRM	97	162	9.49e-21	SMART
DSRM	199	265	5.54e-22	SMART
PDB:4DKK\|A	355	469	3e-69	PDB
Blast:DSRM	401	466	3e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000109238

SMART Domains

Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536

Domain	Start	End	E-Value	Type
Blast:DSRM	1	73	5e-21	BLAST
DSRM	97	168	4.04e-15	SMART
DSRM	205	271	5.54e-22	SMART
Pfam:Staufen_C	364	475	5.9e-51	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163437

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164974

SMART Domains

Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:CAS_CSE1	24	72	5.4e-16	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000168599

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169290

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,164,448	C2548*	probably null	Het
Adamts15	C	T	9: 30,904,656	V635M	probably damaging	Het
AI314180	C	T	4: 58,872,756	V182M	probably damaging	Het
Aim2	A	T	1: 173,455,354	M1L	possibly damaging	Het
Ank3	T	C	10: 69,893,509	V700A	unknown	Het
Arhgap10	T	C	8: 77,310,842	T586A	probably benign	Het
Arhgap45	G	A	10: 80,027,872	A819T	probably damaging	Het
Arhgef4	G	A	1: 34,810,374	V349I	probably benign	Het
Atp1a1	A	G	3: 101,584,854	F569L	possibly damaging	Het
Btbd10	T	A	7: 113,322,792		probably null	Het
Capza2	G	A	6: 17,665,382	D270N	probably benign	Het
Cobll1	T	C	2: 65,099,231	N584D	probably benign	Het
Coro1c	T	A	5: 113,850,815	I156F	probably benign	Het
Cpsf3	T	C	12: 21,300,177	I299T	probably benign	Het
D5Ertd579e	T	C	5: 36,615,470	E527G	probably damaging	Het
Dcbld2	T	C	16: 58,433,347	L149S	possibly damaging	Het
Egflam	C	A	15: 7,212,152	W925L	probably damaging	Het
Ehmt2	A	G	17: 34,911,420	N1071D	probably damaging	Het
Eif3g	A	T	9: 20,897,730	S93T	probably damaging	Het
Eipr1	A	G	12: 28,863,107	E269G		Het
Eng	C	A	2: 32,678,922	T487K	possibly damaging	Het
Epb41l3	T	C	17: 69,210,366	Y130H	probably damaging	Het
F5	A	T	1: 164,192,265	R770*	probably null	Het
Fam227a	A	G	15: 79,640,660	F201S	probably damaging	Het
Fam50b	G	A	13: 34,746,864	E108K	probably benign	Het
Fn1	A	G	1: 71,599,665	I1971T	probably damaging	Het
Fsip2	T	A	2: 82,984,744	F3607Y	probably benign	Het
Fsip2	A	T	2: 82,987,677	I4585L	probably benign	Het
Gas1	T	C	13: 60,176,118	N275S		Het
Hus1b	A	G	13: 30,947,232	V148A	probably benign	Het
Ighmbp2	A	G	19: 3,266,365	L575P	possibly damaging	Het
Igsf21	A	T	4: 140,028,231	F371Y	probably damaging	Het
Jade1	G	T	3: 41,613,288	R597L	probably benign	Het
Krt4	A	G	15: 101,920,549		probably null	Het
Lap3	T	C	5: 45,509,491	S412P	probably benign	Het
Lifr	A	G	15: 7,187,015	T824A	probably damaging	Het
Megf6	T	A	4: 154,268,619	C1307*	probably null	Het
Ndufb10	A	T	17: 24,724,192	V48E	possibly damaging	Het
Nelfa	T	C	5: 33,922,013	K72R	possibly damaging	Het
Obscn	C	T	11: 58,995,960	V7767I	unknown	Het
Pptc7	T	A	5: 122,319,819	C284S	probably benign	Het
Pxdc1	A	G	13: 34,628,815	S218P	probably damaging	Het
Rabep1	T	A	11: 70,884,929	W110R	probably damaging	Het
Ren1	T	C	1: 133,354,269	Y79H	possibly damaging	Het
Ripor3	T	C	2: 167,983,759	S760G	probably benign	Het
Setd1a	A	G	7: 127,796,243	E1327G	unknown	Het
Setd5	T	C	6: 113,114,913	W232R	probably damaging	Het
Slf1	A	T	13: 77,112,671	H171Q	probably damaging	Het
Smoc1	A	G	12: 81,167,666	D285G	probably damaging	Het
Ssfa2	A	G	2: 79,658,152	R860G	probably damaging	Het
Taf10	T	C	7: 105,743,927	Y97C	probably damaging	Het
Tgfbr2	G	A	9: 116,109,955	S293L	possibly damaging	Het
Tmem181a	A	G	17: 6,295,800	I190V	probably benign	Het
Traf6	C	T	2: 101,691,480	T220I	possibly damaging	Het
Ube4b	T	C	4: 149,351,516	N716D	probably benign	Het
Unc5d	T	A	8: 28,844,827	K157N	probably damaging	Het
Usp19	G	A	9: 108,500,178	R1255H	probably damaging	Het
Vmn2r12	T	A	5: 109,090,483	I464F	probably damaging	Het
Zbtb20	A	T	16: 43,577,080		probably benign	Het
Zfp790	T	G	7: 29,829,780	L630R	possibly damaging	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACACCACGTCACTAAGTATG -3'
(R):5'- TCATGCTGGAATCCATCAGGG -3'

Sequencing Primer
(F):5'- CTTACTGTCTGAGTATAATGCATGC -3'
(R):5'- CTGGAATCCATCAGGGTTAGG -3'

Posted On

2020-07-13