Incidental Mutation 'R8175:AI314180'
ID634275
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R8175 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58872756 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 182 (V182M)
Ref Sequence ENSEMBL: ENSMUSP00000099953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055822] [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000134848] [ENSMUST00000144512] [ENSMUST00000149301]
Predicted Effect probably damaging
Transcript: ENSMUST00000055822
AA Change: V182M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061113
Gene: ENSMUSG00000050812
AA Change: V182M

DomainStartEndE-ValueType
Pfam:Ecm29 10 359 2.5e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102889
AA Change: V182M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: V182M

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107557
AA Change: V182M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: V182M

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134848
AA Change: V186M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114715
Gene: ENSMUSG00000050812
AA Change: V186M

DomainStartEndE-ValueType
Pfam:Ecm29 14 246 1.4e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144512
AA Change: V182M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118103
Gene: ENSMUSG00000050812
AA Change: V182M

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 2.3e-164 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149301
AA Change: V182M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: V182M

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,164,448 C2548* probably null Het
Adamts15 C T 9: 30,904,656 V635M probably damaging Het
Aim2 A T 1: 173,455,354 M1L possibly damaging Het
Ank3 T C 10: 69,893,509 V700A unknown Het
Arhgap10 T C 8: 77,310,842 T586A probably benign Het
Arhgef4 G A 1: 34,810,374 V349I probably benign Het
Atp1a1 A G 3: 101,584,854 F569L possibly damaging Het
Btbd10 T A 7: 113,322,792 probably null Het
Capza2 G A 6: 17,665,382 D270N probably benign Het
Cobll1 T C 2: 65,099,231 N584D probably benign Het
Coro1c T A 5: 113,850,815 I156F probably benign Het
Cpsf3 T C 12: 21,300,177 I299T probably benign Het
Cse1l T A 2: 166,943,208 probably null Het
D5Ertd579e T C 5: 36,615,470 E527G probably damaging Het
Dcbld2 T C 16: 58,433,347 L149S possibly damaging Het
Egflam C A 15: 7,212,152 W925L probably damaging Het
Ehmt2 A G 17: 34,911,420 N1071D probably damaging Het
Eif3g A T 9: 20,897,730 S93T probably damaging Het
Eng C A 2: 32,678,922 T487K possibly damaging Het
Epb41l3 T C 17: 69,210,366 Y130H probably damaging Het
F5 A T 1: 164,192,265 R770* probably null Het
Fam227a A G 15: 79,640,660 F201S probably damaging Het
Fam50b G A 13: 34,746,864 E108K probably benign Het
Fam65c T C 2: 167,983,759 S760G probably benign Het
Fn1 A G 1: 71,599,665 I1971T probably damaging Het
Fsip2 T A 2: 82,984,744 F3607Y probably benign Het
Fsip2 A T 2: 82,987,677 I4585L probably benign Het
Gas1 T C 13: 60,176,118 N275S Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hus1b A G 13: 30,947,232 V148A probably benign Het
Ighmbp2 A G 19: 3,266,365 L575P possibly damaging Het
Igsf21 A T 4: 140,028,231 F371Y probably damaging Het
Jade1 G T 3: 41,613,288 R597L probably benign Het
Krt4 A G 15: 101,920,549 probably null Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lifr A G 15: 7,187,015 T824A probably damaging Het
Megf6 T A 4: 154,268,619 C1307* probably null Het
Ndufb10 A T 17: 24,724,192 V48E possibly damaging Het
Nelfa T C 5: 33,922,013 K72R possibly damaging Het
Obscn C T 11: 58,995,960 V7767I unknown Het
Pptc7 T A 5: 122,319,819 C284S probably benign Het
Pxdc1 A G 13: 34,628,815 S218P probably damaging Het
Rabep1 T A 11: 70,884,929 W110R probably damaging Het
Ren1 T C 1: 133,354,269 Y79H possibly damaging Het
Setd1a A G 7: 127,796,243 E1327G unknown Het
Setd5 T C 6: 113,114,913 W232R probably damaging Het
Slf1 A T 13: 77,112,671 H171Q probably damaging Het
Smoc1 A G 12: 81,167,666 D285G probably damaging Het
Ssfa2 A G 2: 79,658,152 R860G probably damaging Het
Taf10 T C 7: 105,743,927 Y97C probably damaging Het
Tgfbr2 G A 9: 116,109,955 S293L possibly damaging Het
Tmem181a A G 17: 6,295,800 I190V probably benign Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tssc1 A G 12: 28,863,107 E269G Het
Ube4b T C 4: 149,351,516 N716D probably benign Het
Unc5d T A 8: 28,844,827 K157N probably damaging Het
Usp19 G A 9: 108,500,178 R1255H probably damaging Het
Vmn2r12 T A 5: 109,090,483 I464F probably damaging Het
Zbtb20 A T 16: 43,577,080 probably benign Het
Zfp790 T G 7: 29,829,780 L630R possibly damaging Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense probably damaging 1.00
BB016:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7929:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R8010:AI314180 UTSW 4 58832681 missense unknown
R8082:AI314180 UTSW 4 58807852 missense probably benign 0.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
R8326:AI314180 UTSW 4 58847093 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCTGTTCCAACTGTTCAGG -3'
(R):5'- AGGTTCTTCTGATTAATTTGCTGAC -3'

Sequencing Primer
(F):5'- AACTGTTCAGGTGTCCACG -3'
(R):5'- CTATAGAGTGATTTCCAGGACAGCC -3'
Posted On2020-07-13