Incidental Mutation 'R0694:Hus1'
ID63429
Institutional Source Beutler Lab
Gene Symbol Hus1
Ensembl Gene ENSMUSG00000020413
Gene NameHUS1 checkpoint clamp component
Synonyms
MMRRC Submission 038879-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0694 (G1)
Quality Score82
Status Not validated
Chromosome11
Chromosomal Location8993137-9011191 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 9007531 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 144 (W144*)
Ref Sequence ENSEMBL: ENSMUSP00000114339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020683] [ENSMUST00000129115]
Predicted Effect probably null
Transcript: ENSMUST00000020683
AA Change: W144*
SMART Domains Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413
AA Change: W144*

DomainStartEndE-ValueType
Pfam:Hus1 1 280 5.1e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127578
Predicted Effect probably null
Transcript: ENSMUST00000129115
AA Change: W144*
SMART Domains Protein: ENSMUSP00000114339
Gene: ENSMUSG00000020413
AA Change: W144*

DomainStartEndE-ValueType
Pfam:Hus1 1 280 4.8e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152890
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of a cell cycle checkpoint complex that causes cell cycle arrest in response to bulky DNA lesions and DNA replication blockage. Together with the proteins Rad9 and Rad1, the encoded protein forms a heterotrimeric complex known as the 9-1-1 complex. Mice lacking the encoded protein develop spontaneous chromosomal abnormalities resulting in embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in yolk sac vascularization, placental abnormalities, extensive apoptosis, and midgestational lethality. Mutant cells show increased chromosomal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b C T 13: 14,187,834 T961I probably damaging Het
Asb13 G T 13: 3,649,480 A227S probably benign Het
Atp6v1g1 C T 4: 63,549,993 R78W probably benign Het
Bglap2 C T 3: 88,378,416 D31N possibly damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Fbxo22 T A 9: 55,221,139 I248N probably damaging Het
Fbxo39 G A 11: 72,318,469 R385Q probably benign Het
Glyr1 T C 16: 5,026,560 N284S probably damaging Het
Kcna1 T C 6: 126,642,245 T371A probably damaging Het
Prkdc A T 16: 15,768,637 N2510I probably damaging Het
Ptprn2 G T 12: 116,824,355 A105S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sema6d T C 2: 124,664,041 S633P probably damaging Het
Sulf2 T C 2: 166,085,791 N362S probably damaging Het
Tmem136 C T 9: 43,111,626 W126* probably null Het
Trim50 A T 5: 135,353,545 I84L probably benign Het
Trpc3 A T 3: 36,671,555 F91I possibly damaging Het
Zfp804a A G 2: 82,053,804 Y5C probably damaging Het
Other mutations in Hus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Hus1 APN 11 9000082 missense probably benign 0.00
IGL01974:Hus1 APN 11 9000088 missense possibly damaging 0.58
IGL02301:Hus1 APN 11 8996915 missense probably benign
IGL02436:Hus1 APN 11 9006057 missense possibly damaging 0.93
R2108:Hus1 UTSW 11 9011110 start codon destroyed probably null 1.00
R2128:Hus1 UTSW 11 9006011 missense probably damaging 1.00
R2329:Hus1 UTSW 11 9007492 critical splice donor site probably null
R4363:Hus1 UTSW 11 8998676 missense probably damaging 1.00
R4420:Hus1 UTSW 11 9000133 missense probably damaging 1.00
R4453:Hus1 UTSW 11 9006035 missense probably damaging 1.00
R4572:Hus1 UTSW 11 9007617 splice site probably null
R4818:Hus1 UTSW 11 8996808 utr 3 prime probably benign
R4913:Hus1 UTSW 11 8996856 missense probably benign 0.03
R4989:Hus1 UTSW 11 9006027 missense probably damaging 0.97
R5402:Hus1 UTSW 11 9010240 critical splice donor site probably null
R5902:Hus1 UTSW 11 9010669 intron probably benign
R6402:Hus1 UTSW 11 9010407 missense probably damaging 1.00
R7792:Hus1 UTSW 11 9000133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTTGCCCTCCTGTGGAAAG -3'
(R):5'- CTCAGTCACCACGATGTTGAGAGAC -3'

Sequencing Primer
(F):5'- CCCTCCTGTGGAAAGTGTGG -3'
(R):5'- CGATGTTGAGAGACTCGCAG -3'
Posted On2013-07-30