Incidental Mutation 'R8175:Setd1a'
ID 634291
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 067600-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8175 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127395415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1327 (E1327G)
Ref Sequence ENSEMBL: ENSMUSP00000047672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000125188] [ENSMUST00000138432] [ENSMUST00000139068] [ENSMUST00000154987] [ENSMUST00000155005] [ENSMUST00000206674]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: E1327G
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: E1327G

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: E1327G
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: E1327G

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125188
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: E784G
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 C T 9: 30,815,952 (GRCm39) V635M probably damaging Het
Aim2 A T 1: 173,282,920 (GRCm39) M1L possibly damaging Het
Ank3 T C 10: 69,729,339 (GRCm39) V700A unknown Het
Arhgap10 T C 8: 78,037,471 (GRCm39) T586A probably benign Het
Arhgap45 G A 10: 79,863,706 (GRCm39) A819T probably damaging Het
Arhgef4 G A 1: 34,849,455 (GRCm39) V349I probably benign Het
Atp1a1 A G 3: 101,492,170 (GRCm39) F569L possibly damaging Het
Btbd10 T A 7: 112,921,999 (GRCm39) probably null Het
Capza2 G A 6: 17,665,381 (GRCm39) D270N probably benign Het
Cobll1 T C 2: 64,929,575 (GRCm39) N584D probably benign Het
Coro1c T A 5: 113,988,876 (GRCm39) I156F probably benign Het
Cpsf3 T C 12: 21,350,178 (GRCm39) I299T probably benign Het
Cse1l T A 2: 166,785,128 (GRCm39) probably null Het
D5Ertd579e T C 5: 36,772,814 (GRCm39) E527G probably damaging Het
Dcbld2 T C 16: 58,253,710 (GRCm39) L149S possibly damaging Het
Ecpas C T 4: 58,872,756 (GRCm39) V182M probably damaging Het
Egflam C A 15: 7,241,633 (GRCm39) W925L probably damaging Het
Ehmt2 A G 17: 35,130,396 (GRCm39) N1071D probably damaging Het
Eif3g A T 9: 20,809,026 (GRCm39) S93T probably damaging Het
Eipr1 A G 12: 28,913,106 (GRCm39) E269G Het
Eng C A 2: 32,568,934 (GRCm39) T487K possibly damaging Het
Epb41l3 T C 17: 69,517,361 (GRCm39) Y130H probably damaging Het
F5 A T 1: 164,019,834 (GRCm39) R770* probably null Het
Fam227a A G 15: 79,524,861 (GRCm39) F201S probably damaging Het
Fam50b G A 13: 34,930,847 (GRCm39) E108K probably benign Het
Fcgbpl1 T A 7: 27,863,873 (GRCm39) C2548* probably null Het
Fn1 A G 1: 71,638,824 (GRCm39) I1971T probably damaging Het
Fsip2 T A 2: 82,815,088 (GRCm39) F3607Y probably benign Het
Fsip2 A T 2: 82,818,021 (GRCm39) I4585L probably benign Het
Gas1 T C 13: 60,323,932 (GRCm39) N275S Het
Hus1b A G 13: 31,131,215 (GRCm39) V148A probably benign Het
Ighmbp2 A G 19: 3,316,365 (GRCm39) L575P possibly damaging Het
Igsf21 A T 4: 139,755,542 (GRCm39) F371Y probably damaging Het
Itprid2 A G 2: 79,488,496 (GRCm39) R860G probably damaging Het
Jade1 G T 3: 41,567,723 (GRCm39) R597L probably benign Het
Krt4 A G 15: 101,828,984 (GRCm39) probably null Het
Lap3 T C 5: 45,666,833 (GRCm39) S412P probably benign Het
Lifr A G 15: 7,216,496 (GRCm39) T824A probably damaging Het
Megf6 T A 4: 154,353,076 (GRCm39) C1307* probably null Het
Ndufb10 A T 17: 24,943,166 (GRCm39) V48E possibly damaging Het
Nelfa T C 5: 34,079,357 (GRCm39) K72R possibly damaging Het
Obscn C T 11: 58,886,786 (GRCm39) V7767I unknown Het
Pptc7 T A 5: 122,457,882 (GRCm39) C284S probably benign Het
Pxdc1 A G 13: 34,812,798 (GRCm39) S218P probably damaging Het
Rabep1 T A 11: 70,775,755 (GRCm39) W110R probably damaging Het
Ren1 T C 1: 133,282,007 (GRCm39) Y79H possibly damaging Het
Ripor3 T C 2: 167,825,679 (GRCm39) S760G probably benign Het
Setd5 T C 6: 113,091,874 (GRCm39) W232R probably damaging Het
Slf1 A T 13: 77,260,790 (GRCm39) H171Q probably damaging Het
Smoc1 A G 12: 81,214,440 (GRCm39) D285G probably damaging Het
Taf10 T C 7: 105,393,134 (GRCm39) Y97C probably damaging Het
Tgfbr2 G A 9: 115,939,023 (GRCm39) S293L possibly damaging Het
Tmem181a A G 17: 6,346,075 (GRCm39) I190V probably benign Het
Traf6 C T 2: 101,521,825 (GRCm39) T220I possibly damaging Het
Ube4b T C 4: 149,435,973 (GRCm39) N716D probably benign Het
Unc5d T A 8: 29,334,855 (GRCm39) K157N probably damaging Het
Usp19 G A 9: 108,377,377 (GRCm39) R1255H probably damaging Het
Vmn2r12 T A 5: 109,238,349 (GRCm39) I464F probably damaging Het
Zbtb20 A T 16: 43,397,443 (GRCm39) probably benign Het
Zfp790 T G 7: 29,529,205 (GRCm39) L630R possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCGCTCTACTGAAGAAGAGG -3'
(R):5'- TCTGAAGACTCGGACTCCTC -3'

Sequencing Primer
(F):5'- AGTAGACCTGGCAGTACTGG -3'
(R):5'- GAAGACTCGGACTCCTCCTCTTC -3'
Posted On 2020-07-13