Incidental Mutation 'R8175:Tmem181a'
ID634316
Institutional Source Beutler Lab
Gene Symbol Tmem181a
Ensembl Gene ENSMUSG00000038141
Gene Nametransmembrane protein 181A
SynonymsTmem181, 5930418K15Rik, Gpr178, C76977
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8175 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location6256860-6308314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6295800 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 190 (I190V)
Ref Sequence ENSEMBL: ENSMUSP00000086333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088940]
Predicted Effect probably benign
Transcript: ENSMUST00000088940
AA Change: I190V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000086333
Gene: ENSMUSG00000038141
AA Change: I190V

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 127 422 1e-100 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]; Wollscheid et al., 2009 [PubMed 19349973]).[supplied by OMIM, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,164,448 C2548* probably null Het
Adamts15 C T 9: 30,904,656 V635M probably damaging Het
AI314180 C T 4: 58,872,756 V182M probably damaging Het
Aim2 A T 1: 173,455,354 M1L possibly damaging Het
Ank3 T C 10: 69,893,509 V700A unknown Het
Arhgap10 T C 8: 77,310,842 T586A probably benign Het
Arhgef4 G A 1: 34,810,374 V349I probably benign Het
Atp1a1 A G 3: 101,584,854 F569L possibly damaging Het
Btbd10 T A 7: 113,322,792 probably null Het
Capza2 G A 6: 17,665,382 D270N probably benign Het
Cobll1 T C 2: 65,099,231 N584D probably benign Het
Coro1c T A 5: 113,850,815 I156F probably benign Het
Cpsf3 T C 12: 21,300,177 I299T probably benign Het
Cse1l T A 2: 166,943,208 probably null Het
D5Ertd579e T C 5: 36,615,470 E527G probably damaging Het
Dcbld2 T C 16: 58,433,347 L149S possibly damaging Het
Egflam C A 15: 7,212,152 W925L probably damaging Het
Ehmt2 A G 17: 34,911,420 N1071D probably damaging Het
Eif3g A T 9: 20,897,730 S93T probably damaging Het
Eng C A 2: 32,678,922 T487K possibly damaging Het
Epb41l3 T C 17: 69,210,366 Y130H probably damaging Het
F5 A T 1: 164,192,265 R770* probably null Het
Fam227a A G 15: 79,640,660 F201S probably damaging Het
Fam50b G A 13: 34,746,864 E108K probably benign Het
Fam65c T C 2: 167,983,759 S760G probably benign Het
Fn1 A G 1: 71,599,665 I1971T probably damaging Het
Fsip2 T A 2: 82,984,744 F3607Y probably benign Het
Fsip2 A T 2: 82,987,677 I4585L probably benign Het
Gas1 T C 13: 60,176,118 N275S Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hus1b A G 13: 30,947,232 V148A probably benign Het
Ighmbp2 A G 19: 3,266,365 L575P possibly damaging Het
Igsf21 A T 4: 140,028,231 F371Y probably damaging Het
Jade1 G T 3: 41,613,288 R597L probably benign Het
Krt4 A G 15: 101,920,549 probably null Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lifr A G 15: 7,187,015 T824A probably damaging Het
Megf6 T A 4: 154,268,619 C1307* probably null Het
Ndufb10 A T 17: 24,724,192 V48E possibly damaging Het
Nelfa T C 5: 33,922,013 K72R possibly damaging Het
Obscn C T 11: 58,995,960 V7767I unknown Het
Pptc7 T A 5: 122,319,819 C284S probably benign Het
Pxdc1 A G 13: 34,628,815 S218P probably damaging Het
Rabep1 T A 11: 70,884,929 W110R probably damaging Het
Ren1 T C 1: 133,354,269 Y79H possibly damaging Het
Setd1a A G 7: 127,796,243 E1327G unknown Het
Setd5 T C 6: 113,114,913 W232R probably damaging Het
Slf1 A T 13: 77,112,671 H171Q probably damaging Het
Smoc1 A G 12: 81,167,666 D285G probably damaging Het
Ssfa2 A G 2: 79,658,152 R860G probably damaging Het
Taf10 T C 7: 105,743,927 Y97C probably damaging Het
Tgfbr2 G A 9: 116,109,955 S293L possibly damaging Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tssc1 A G 12: 28,863,107 E269G Het
Ube4b T C 4: 149,351,516 N716D probably benign Het
Unc5d T A 8: 28,844,827 K157N probably damaging Het
Usp19 G A 9: 108,500,178 R1255H probably damaging Het
Vmn2r12 T A 5: 109,090,483 I464F probably damaging Het
Zbtb20 A T 16: 43,577,080 probably benign Het
Zfp790 T G 7: 29,829,780 L630R possibly damaging Het
Other mutations in Tmem181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tmem181a APN 17 6297256 missense probably damaging 1.00
IGL03027:Tmem181a APN 17 6298219 missense probably damaging 1.00
a_team UTSW 17 6295786 missense probably damaging 0.99
abraham UTSW 17 6290599 missense probably benign 0.03
PIT4651001:Tmem181a UTSW 17 6300895 missense probably benign
R1966:Tmem181a UTSW 17 6303226 missense probably benign
R2139:Tmem181a UTSW 17 6298206 missense probably damaging 1.00
R2323:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R2324:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3001:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3002:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3003:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3034:Tmem181a UTSW 17 6280626 missense possibly damaging 0.50
R3425:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3426:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3427:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3499:Tmem181a UTSW 17 6280619 nonsense probably null
R3683:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3893:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4226:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4227:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4429:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4430:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4465:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4466:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4467:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4496:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4728:Tmem181a UTSW 17 6290599 missense probably benign 0.03
R4822:Tmem181a UTSW 17 6280665 missense probably benign 0.00
R5301:Tmem181a UTSW 17 6295795 missense possibly damaging 0.52
R5991:Tmem181a UTSW 17 6289037 missense probably damaging 1.00
R6052:Tmem181a UTSW 17 6280615 missense probably damaging 1.00
R6222:Tmem181a UTSW 17 6300917 missense probably benign 0.29
R7131:Tmem181a UTSW 17 6297972 missense probably damaging 0.98
R7231:Tmem181a UTSW 17 6297920 missense possibly damaging 0.81
R7374:Tmem181a UTSW 17 6304258 missense possibly damaging 0.85
R7437:Tmem181a UTSW 17 6303265 missense possibly damaging 0.70
R7592:Tmem181a UTSW 17 6289020 missense probably benign 0.00
R8327:Tmem181a UTSW 17 6301405 missense probably damaging 1.00
R8385:Tmem181a UTSW 17 6288999 missense probably benign 0.10
RF010:Tmem181a UTSW 17 6280703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACCATGGGAGAACTGTTTCTG -3'
(R):5'- GGTCAGCAATGACTCTCACAC -3'

Sequencing Primer
(F):5'- CCATGGGAGAACTGTTTCTGGTAGTC -3'
(R):5'- TGACTCTCACACTACACAGGAGAGAG -3'
Posted On2020-07-13