Incidental Mutation 'R8175:Ighmbp2'
ID634320
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8175 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3266365 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 575 (L575P)
Ref Sequence ENSEMBL: ENSMUSP00000025751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025751
AA Change: L575P

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: L575P

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119292
AA Change: L575P

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831
AA Change: L575P

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,164,448 C2548* probably null Het
Adamts15 C T 9: 30,904,656 V635M probably damaging Het
AI314180 C T 4: 58,872,756 V182M probably damaging Het
Aim2 A T 1: 173,455,354 M1L possibly damaging Het
Ank3 T C 10: 69,893,509 V700A unknown Het
Arhgap10 T C 8: 77,310,842 T586A probably benign Het
Arhgef4 G A 1: 34,810,374 V349I probably benign Het
Atp1a1 A G 3: 101,584,854 F569L possibly damaging Het
Btbd10 T A 7: 113,322,792 probably null Het
Capza2 G A 6: 17,665,382 D270N probably benign Het
Cobll1 T C 2: 65,099,231 N584D probably benign Het
Coro1c T A 5: 113,850,815 I156F probably benign Het
Cpsf3 T C 12: 21,300,177 I299T probably benign Het
Cse1l T A 2: 166,943,208 probably null Het
D5Ertd579e T C 5: 36,615,470 E527G probably damaging Het
Dcbld2 T C 16: 58,433,347 L149S possibly damaging Het
Egflam C A 15: 7,212,152 W925L probably damaging Het
Ehmt2 A G 17: 34,911,420 N1071D probably damaging Het
Eif3g A T 9: 20,897,730 S93T probably damaging Het
Eng C A 2: 32,678,922 T487K possibly damaging Het
Epb41l3 T C 17: 69,210,366 Y130H probably damaging Het
F5 A T 1: 164,192,265 R770* probably null Het
Fam227a A G 15: 79,640,660 F201S probably damaging Het
Fam50b G A 13: 34,746,864 E108K probably benign Het
Fam65c T C 2: 167,983,759 S760G probably benign Het
Fn1 A G 1: 71,599,665 I1971T probably damaging Het
Fsip2 T A 2: 82,984,744 F3607Y probably benign Het
Fsip2 A T 2: 82,987,677 I4585L probably benign Het
Gas1 T C 13: 60,176,118 N275S Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hus1b A G 13: 30,947,232 V148A probably benign Het
Igsf21 A T 4: 140,028,231 F371Y probably damaging Het
Jade1 G T 3: 41,613,288 R597L probably benign Het
Krt4 A G 15: 101,920,549 probably null Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lifr A G 15: 7,187,015 T824A probably damaging Het
Megf6 T A 4: 154,268,619 C1307* probably null Het
Ndufb10 A T 17: 24,724,192 V48E possibly damaging Het
Nelfa T C 5: 33,922,013 K72R possibly damaging Het
Obscn C T 11: 58,995,960 V7767I unknown Het
Pptc7 T A 5: 122,319,819 C284S probably benign Het
Pxdc1 A G 13: 34,628,815 S218P probably damaging Het
Rabep1 T A 11: 70,884,929 W110R probably damaging Het
Ren1 T C 1: 133,354,269 Y79H possibly damaging Het
Setd1a A G 7: 127,796,243 E1327G unknown Het
Setd5 T C 6: 113,114,913 W232R probably damaging Het
Slf1 A T 13: 77,112,671 H171Q probably damaging Het
Smoc1 A G 12: 81,167,666 D285G probably damaging Het
Ssfa2 A G 2: 79,658,152 R860G probably damaging Het
Taf10 T C 7: 105,743,927 Y97C probably damaging Het
Tgfbr2 G A 9: 116,109,955 S293L possibly damaging Het
Tmem181a A G 17: 6,295,800 I190V probably benign Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tssc1 A G 12: 28,863,107 E269G Het
Ube4b T C 4: 149,351,516 N716D probably benign Het
Unc5d T A 8: 28,844,827 K157N probably damaging Het
Usp19 G A 9: 108,500,178 R1255H probably damaging Het
Vmn2r12 T A 5: 109,090,483 I464F probably damaging Het
Zbtb20 A T 16: 43,577,080 probably benign Het
Zfp790 T G 7: 29,829,780 L630R possibly damaging Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1756:Ighmbp2 UTSW 19 3268669 missense probably damaging 0.99
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R4806:Ighmbp2 UTSW 19 3261589 missense probably damaging 1.00
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5274:Ighmbp2 UTSW 19 3265518 missense probably damaging 1.00
R5319:Ighmbp2 UTSW 19 3271646 missense probably damaging 0.99
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5698:Ighmbp2 UTSW 19 3274538 missense probably damaging 1.00
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense probably benign 0.05
R7257:Ighmbp2 UTSW 19 3266405 missense probably damaging 1.00
R7274:Ighmbp2 UTSW 19 3264951 missense probably benign
R7567:Ighmbp2 UTSW 19 3272981 missense probably benign 0.01
R7737:Ighmbp2 UTSW 19 3274467 missense unknown
R7819:Ighmbp2 UTSW 19 3267276 missense possibly damaging 0.46
R7877:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
R8417:Ighmbp2 UTSW 19 3261590 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3265635 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3267242 missense probably null 1.00
Z1177:Ighmbp2 UTSW 19 3271665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTAAGTCTCTTGGGGCC -3'
(R):5'- TACAAACCTCAGGGCAGCTTG -3'

Sequencing Primer
(F):5'- TCTCTTGGGGCCCACCATG -3'
(R):5'- CTGCTGTGGTCACTGAAAGGTAC -3'
Posted On2020-07-13