Incidental Mutation 'R8176:March4'
ID634323
Institutional Source Beutler Lab
Gene Symbol March4
Ensembl Gene ENSMUSG00000039372
Gene Namemembrane-associated ring finger (C3HC4) 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R8176 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location72427112-72536930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72534839 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 100 (E100G)
Ref Sequence ENSEMBL: ENSMUSP00000042803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047786]
Predicted Effect probably damaging
Transcript: ENSMUST00000047786
AA Change: E100G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042803
Gene: ENSMUSG00000039372
AA Change: E100G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 125 135 N/A INTRINSIC
RINGv 161 208 3.5e-18 SMART
transmembrane domain 235 257 N/A INTRINSIC
Blast:AAA 263 290 4e-9 BLAST
low complexity region 344 360 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH4 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH4 reduces surface accumulation of several membrane glycoproteins by directing them to the endosomal compartment (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,185,136 F172I noncoding transcript Het
A26c2 T C 7: 62,783,035 probably null Het
Aatk A G 11: 120,016,415 V154A probably damaging Het
Abca6 A C 11: 110,244,194 V255G probably benign Het
Adam8 T C 7: 139,988,873 K211E probably benign Het
Alg12 A G 15: 88,805,881 V470A possibly damaging Het
Anks1b C A 10: 90,069,491 H231Q probably damaging Het
Bcl2 T C 1: 106,712,798 Y28C probably damaging Het
Bms1 G T 6: 118,418,450 F45L probably damaging Het
Btd T A 14: 31,662,116 F20I probably benign Het
C1rl T C 6: 124,493,885 S51P probably benign Het
Capn7 C A 14: 31,347,772 F184L probably benign Het
Cd300lg A T 11: 102,041,564 probably benign Het
Cdc34 T C 10: 79,682,528 Y39H probably damaging Het
Cenpe A G 3: 135,230,090 K429E probably damaging Het
Cfap43 T C 19: 47,795,675 N473S probably benign Het
Cntln C T 4: 84,888,689 T136I probably damaging Het
Cyfip1 A T 7: 55,924,427 L1032F probably benign Het
Dach1 C T 14: 97,916,480 V392I probably benign Het
Dnah14 C T 1: 181,657,033 S1590L probably damaging Het
Dsp T C 13: 38,192,810 Y1524H possibly damaging Het
Dusp13 T C 14: 21,747,481 I103V possibly damaging Het
Efhb T C 17: 53,400,846 Y763C probably damaging Het
Fam102a A G 2: 32,563,612 T158A probably benign Het
Fam117a G T 11: 95,337,139 R25L unknown Het
Fcgbp T C 7: 28,091,749 S812P possibly damaging Het
Fgd5 T A 6: 91,987,984 N399K probably benign Het
Foxi3 T A 6: 70,957,033 I168N probably damaging Het
Frem2 A T 3: 53,655,340 I582K possibly damaging Het
Gm21915 T A 9: 40,670,970 S120T probably benign Het
Gtf3c5 A G 2: 28,570,417 probably null Het
Hecw1 A T 13: 14,247,701 probably null Het
Hsf2 T A 10: 57,505,194 Y293* probably null Het
Ints10 T A 8: 68,802,951 Y198N probably damaging Het
Iqgap3 A G 3: 88,094,650 E399G probably damaging Het
Itsn1 T A 16: 91,848,709 probably null Het
Kcnh8 T C 17: 52,978,094 S1031P probably damaging Het
Llgl1 A G 11: 60,706,561 T279A probably benign Het
Ly6a C T 15: 74,996,451 probably null Het
Mta1 A G 12: 113,120,836 E84G probably benign Het
Myh7b A G 2: 155,625,966 Y808C probably benign Het
Ncoa1 A G 12: 4,267,858 V1158A possibly damaging Het
Npepps A G 11: 97,236,151 S428P probably damaging Het
Olfr1408 C T 1: 173,130,816 V134I probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr774 T G 10: 129,238,878 M243R probably benign Het
Onecut2 A T 18: 64,340,860 T161S possibly damaging Het
Pdp2 A G 8: 104,595,055 D512G probably damaging Het
Pex11b G T 3: 96,643,711 V171L probably benign Het
Ppil3 A T 1: 58,440,919 C32* probably null Het
Prune2 T C 19: 17,118,292 Y387H probably damaging Het
Rbp3 C A 14: 33,955,648 H518N possibly damaging Het
Rhot2 T C 17: 25,844,094 Y58C probably damaging Het
Sec16b C A 1: 157,535,411 H271N probably damaging Het
Sgol2a A G 1: 58,017,093 D812G possibly damaging Het
Skap2 T C 6: 51,907,898 E261G probably damaging Het
Spata31d1b A G 13: 59,717,303 N755S probably benign Het
Stat5a T A 11: 100,876,863 M419K probably damaging Het
Tecta C T 9: 42,359,169 C1281Y probably damaging Het
Tm9sf2 T G 14: 122,137,501 S196R probably benign Het
Trpm8 A T 1: 88,365,115 H946L probably benign Het
Other mutations in March4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:March4 APN 1 72452531 nonsense probably null
IGL02996:March4 APN 1 72428899 nonsense probably null
R0245:March4 UTSW 1 72534781 missense probably benign 0.00
R2865:March4 UTSW 1 72452575 missense probably damaging 1.00
R4386:March4 UTSW 1 72428814 missense probably benign 0.00
R4917:March4 UTSW 1 72428779 missense probably benign 0.27
R4918:March4 UTSW 1 72428779 missense probably benign 0.27
R5812:March4 UTSW 1 72428917 missense probably benign
R6266:March4 UTSW 1 72452488 missense probably damaging 1.00
R7247:March4 UTSW 1 72452478 nonsense probably null
R7619:March4 UTSW 1 72534989 missense possibly damaging 0.89
R7643:March4 UTSW 1 72447220 missense probably damaging 1.00
Z1176:March4 UTSW 1 72452500 missense probably damaging 1.00
Z1177:March4 UTSW 1 72428957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTCATACCACTGTCCAAGC -3'
(R):5'- ATCACATGCTCATGCCCCTG -3'

Sequencing Primer
(F):5'- GCTACTTCCCAGAGAGTAGCAGTC -3'
(R):5'- TACAGCTGTGGACTGTGCAC -3'
Posted On2020-07-13