Incidental Mutation 'R8176:Sec16b'
ID634326
Institutional Source Beutler Lab
Gene Symbol Sec16b
Ensembl Gene ENSMUSG00000026589
Gene NameSEC16 homolog B (S. cerevisiae)
SynonymsRgpr, Lztr2, Rgpr-p117
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8176 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location157506728-157568425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 157535411 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 271 (H271N)
Ref Sequence ENSEMBL: ENSMUSP00000027881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027881] [ENSMUST00000086130] [ENSMUST00000111700] [ENSMUST00000146873]
Predicted Effect probably damaging
Transcript: ENSMUST00000027881
AA Change: H271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027881
Gene: ENSMUSG00000026589
AA Change: H271N

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086130
AA Change: H271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083300
Gene: ENSMUSG00000026589
AA Change: H271N

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 271 370 4.8e-8 PFAM
Pfam:Sec16_C 437 677 2.2e-45 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111700
AA Change: H271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107329
Gene: ENSMUSG00000026589
AA Change: H271N

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146873
AA Change: H82N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119359
Gene: ENSMUSG00000026589
AA Change: H82N

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
Pfam:Sec16 81 182 9.4e-20 PFAM
Pfam:Sec16_C 247 492 4.8e-39 PFAM
low complexity region 606 621 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEC16B is a mammalian homolog of S. cerevisiae Sec16 that is required for organization of transitional endoplasmic reticulum (ER) sites and protein export (Bhattacharyya and Glick, 2007 [PubMed 17192411]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,185,136 F172I noncoding transcript Het
Aatk A G 11: 120,016,415 V154A probably damaging Het
Abca6 A C 11: 110,244,194 V255G probably benign Het
Adam8 T C 7: 139,988,873 K211E probably benign Het
Alg12 A G 15: 88,805,881 V470A possibly damaging Het
Anks1b C A 10: 90,069,491 H231Q probably damaging Het
Bcl2 T C 1: 106,712,798 Y28C probably damaging Het
Bms1 G T 6: 118,418,450 F45L probably damaging Het
Btd T A 14: 31,662,116 F20I probably benign Het
C1rl T C 6: 124,493,885 S51P probably benign Het
Capn7 C A 14: 31,347,772 F184L probably benign Het
Cd300lg A T 11: 102,041,564 probably benign Het
Cdc34 T C 10: 79,682,528 Y39H probably damaging Het
Cenpe A G 3: 135,230,090 K429E probably damaging Het
Cfap43 T C 19: 47,795,675 N473S probably benign Het
Cntln C T 4: 84,888,689 T136I probably damaging Het
Cyfip1 A T 7: 55,924,427 L1032F probably benign Het
Dach1 C T 14: 97,916,480 V392I probably benign Het
Dnah14 C T 1: 181,657,033 S1590L probably damaging Het
Dsp T C 13: 38,192,810 Y1524H possibly damaging Het
Dusp13 T C 14: 21,747,481 I103V possibly damaging Het
Dusp9 AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG X: 73,640,522 probably benign Het
Efhb T C 17: 53,400,846 Y763C probably damaging Het
Fam102a A G 2: 32,563,612 T158A probably benign Het
Fam117a G T 11: 95,337,139 R25L unknown Het
Fcgbp T C 7: 28,091,749 S812P possibly damaging Het
Fgd5 T A 6: 91,987,984 N399K probably benign Het
Foxi3 T A 6: 70,957,033 I168N probably damaging Het
Frem2 A T 3: 53,655,340 I582K possibly damaging Het
Gm21915 T A 9: 40,670,970 S120T probably benign Het
Gtf3c5 A G 2: 28,570,417 probably null Het
Hsf2 T A 10: 57,505,194 Y293* probably null Het
Ints10 T A 8: 68,802,951 Y198N probably damaging Het
Iqgap3 A G 3: 88,094,650 E399G probably damaging Het
Kcnh8 T C 17: 52,978,094 S1031P probably damaging Het
Llgl1 A G 11: 60,706,561 T279A probably benign Het
Ly6a C T 15: 74,996,451 probably null Het
March4 T C 1: 72,534,839 E100G probably damaging Het
Mta1 A G 12: 113,120,836 E84G probably benign Het
Myh7b A G 2: 155,625,966 Y808C probably benign Het
Ncoa1 A G 12: 4,267,858 V1158A possibly damaging Het
Npepps A G 11: 97,236,151 S428P probably damaging Het
Olfr1408 C T 1: 173,130,816 V134I probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr774 T G 10: 129,238,878 M243R probably benign Het
Onecut2 A T 18: 64,340,860 T161S possibly damaging Het
Pdp2 A G 8: 104,595,055 D512G probably damaging Het
Pex11b G T 3: 96,643,711 V171L probably benign Het
Ppil3 A T 1: 58,440,919 C32* probably null Het
Prune2 T C 19: 17,118,292 Y387H probably damaging Het
Rbp3 C A 14: 33,955,648 H518N possibly damaging Het
Rhot2 T C 17: 25,844,094 Y58C probably damaging Het
Sgol2a A G 1: 58,017,093 D812G possibly damaging Het
Skap2 T C 6: 51,907,898 E261G probably damaging Het
Spata31d1b A G 13: 59,717,303 N755S probably benign Het
Stat5a T A 11: 100,876,863 M419K probably damaging Het
Tecta C T 9: 42,359,169 C1281Y probably damaging Het
Tm9sf2 T G 14: 122,137,501 S196R probably benign Het
Trpm8 A T 1: 88,365,115 H946L probably benign Het
Other mutations in Sec16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Sec16b APN 1 157538330 missense probably damaging 1.00
IGL00645:Sec16b APN 1 157566719 missense probably damaging 1.00
IGL00763:Sec16b APN 1 157529257 missense probably benign 0.00
IGL00822:Sec16b APN 1 157564555 missense probably benign 0.05
IGL02225:Sec16b APN 1 157532044 unclassified probably benign
IGL02746:Sec16b APN 1 157546289 splice site probably benign
IGL03031:Sec16b APN 1 157560799 missense probably benign
IGL03117:Sec16b APN 1 157535400 missense probably damaging 1.00
IGL03193:Sec16b APN 1 157535393 missense probably benign 0.01
R0206:Sec16b UTSW 1 157552935 nonsense probably null
R0208:Sec16b UTSW 1 157552935 nonsense probably null
R0349:Sec16b UTSW 1 157532176 splice site probably null
R0433:Sec16b UTSW 1 157534709 nonsense probably null
R0537:Sec16b UTSW 1 157537546 missense possibly damaging 0.91
R0593:Sec16b UTSW 1 157532148 missense probably benign 0.03
R0629:Sec16b UTSW 1 157564863 unclassified probably benign
R1028:Sec16b UTSW 1 157560917 missense probably benign 0.03
R1119:Sec16b UTSW 1 157564834 missense possibly damaging 0.93
R1835:Sec16b UTSW 1 157531312 missense probably benign 0.00
R1894:Sec16b UTSW 1 157552975 missense possibly damaging 0.90
R2307:Sec16b UTSW 1 157535492 missense probably damaging 1.00
R3438:Sec16b UTSW 1 157556758 splice site probably benign
R4788:Sec16b UTSW 1 157561524 missense possibly damaging 0.77
R5109:Sec16b UTSW 1 157564791 nonsense probably null
R5235:Sec16b UTSW 1 157534764 missense probably benign 0.00
R5942:Sec16b UTSW 1 157531350 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6081:Sec16b UTSW 1 157560754 missense probably benign
R7026:Sec16b UTSW 1 157534711 missense possibly damaging 0.80
R7192:Sec16b UTSW 1 157529443 missense probably benign 0.00
R7270:Sec16b UTSW 1 157564462 missense probably damaging 1.00
R7270:Sec16b UTSW 1 157564463 missense probably damaging 1.00
R7404:Sec16b UTSW 1 157531357 missense probably damaging 1.00
R7494:Sec16b UTSW 1 157560799 missense probably benign
R7570:Sec16b UTSW 1 157531395 splice site probably null
R7747:Sec16b UTSW 1 157565472 missense possibly damaging 0.69
R7751:Sec16b UTSW 1 157558060 missense probably damaging 1.00
R7797:Sec16b UTSW 1 157561675 missense unknown
R7913:Sec16b UTSW 1 157529329 missense probably benign 0.00
R7943:Sec16b UTSW 1 157554757 missense probably benign
Z1088:Sec16b UTSW 1 157558024 splice site probably null
Z1176:Sec16b UTSW 1 157551069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCATTTGCACTATAATCTGACG -3'
(R):5'- CCTCAAGCAAAGTGAGAGCC -3'

Sequencing Primer
(F):5'- CGTATTCTTAGAGGGTTAAGTCAGAC -3'
(R):5'- CCTGAGCGAGCCATTGAATTG -3'
Posted On2020-07-13