Incidental Mutation 'R8176:Dnah14'
ID634328
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8176 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181657033 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1590 (S1590L)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: S1590L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,185,136 F172I noncoding transcript Het
Aatk A G 11: 120,016,415 V154A probably damaging Het
Abca6 A C 11: 110,244,194 V255G probably benign Het
Adam8 T C 7: 139,988,873 K211E probably benign Het
Alg12 A G 15: 88,805,881 V470A possibly damaging Het
Anks1b C A 10: 90,069,491 H231Q probably damaging Het
Bcl2 T C 1: 106,712,798 Y28C probably damaging Het
Bms1 G T 6: 118,418,450 F45L probably damaging Het
Btd T A 14: 31,662,116 F20I probably benign Het
C1rl T C 6: 124,493,885 S51P probably benign Het
Capn7 C A 14: 31,347,772 F184L probably benign Het
Cd300lg A T 11: 102,041,564 probably benign Het
Cdc34 T C 10: 79,682,528 Y39H probably damaging Het
Cenpe A G 3: 135,230,090 K429E probably damaging Het
Cfap43 T C 19: 47,795,675 N473S probably benign Het
Cntln C T 4: 84,888,689 T136I probably damaging Het
Cyfip1 A T 7: 55,924,427 L1032F probably benign Het
Dach1 C T 14: 97,916,480 V392I probably benign Het
Dsp T C 13: 38,192,810 Y1524H possibly damaging Het
Dusp13 T C 14: 21,747,481 I103V possibly damaging Het
Dusp9 AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG X: 73,640,522 probably benign Het
Efhb T C 17: 53,400,846 Y763C probably damaging Het
Fam102a A G 2: 32,563,612 T158A probably benign Het
Fam117a G T 11: 95,337,139 R25L unknown Het
Fcgbp T C 7: 28,091,749 S812P possibly damaging Het
Fgd5 T A 6: 91,987,984 N399K probably benign Het
Foxi3 T A 6: 70,957,033 I168N probably damaging Het
Frem2 A T 3: 53,655,340 I582K possibly damaging Het
Gm21915 T A 9: 40,670,970 S120T probably benign Het
Gtf3c5 A G 2: 28,570,417 probably null Het
Hsf2 T A 10: 57,505,194 Y293* probably null Het
Ints10 T A 8: 68,802,951 Y198N probably damaging Het
Iqgap3 A G 3: 88,094,650 E399G probably damaging Het
Kcnh8 T C 17: 52,978,094 S1031P probably damaging Het
Llgl1 A G 11: 60,706,561 T279A probably benign Het
Ly6a C T 15: 74,996,451 probably null Het
March4 T C 1: 72,534,839 E100G probably damaging Het
Mta1 A G 12: 113,120,836 E84G probably benign Het
Myh7b A G 2: 155,625,966 Y808C probably benign Het
Ncoa1 A G 12: 4,267,858 V1158A possibly damaging Het
Npepps A G 11: 97,236,151 S428P probably damaging Het
Olfr1408 C T 1: 173,130,816 V134I probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr774 T G 10: 129,238,878 M243R probably benign Het
Onecut2 A T 18: 64,340,860 T161S possibly damaging Het
Pdp2 A G 8: 104,595,055 D512G probably damaging Het
Pex11b G T 3: 96,643,711 V171L probably benign Het
Ppil3 A T 1: 58,440,919 C32* probably null Het
Prune2 T C 19: 17,118,292 Y387H probably damaging Het
Rbp3 C A 14: 33,955,648 H518N possibly damaging Het
Rhot2 T C 17: 25,844,094 Y58C probably damaging Het
Sec16b C A 1: 157,535,411 H271N probably damaging Het
Sgol2a A G 1: 58,017,093 D812G possibly damaging Het
Skap2 T C 6: 51,907,898 E261G probably damaging Het
Spata31d1b A G 13: 59,717,303 N755S probably benign Het
Stat5a T A 11: 100,876,863 M419K probably damaging Het
Tecta C T 9: 42,359,169 C1281Y probably damaging Het
Tm9sf2 T G 14: 122,137,501 S196R probably benign Het
Trpm8 A T 1: 88,365,115 H946L probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 intron probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGATTTTAACTTTGGCTCC -3'
(R):5'- ATGAATGAATGGCAACCTGC -3'

Sequencing Primer
(F):5'- AACTTTGGCTCCAAATAAGCTTCC -3'
(R):5'- CCTGCAACCGAAGTTTTAAAAATTC -3'
Posted On2020-07-13