Incidental Mutation 'R8176:Cntln'
ID 634336
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 067601-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R8176 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84806926 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 136 (T136I)
Ref Sequence ENSEMBL: ENSMUSP00000099883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect possibly damaging
Transcript: ENSMUST00000047023
AA Change: T136I

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T136I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102819
AA Change: T136I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: T136I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169371
AA Change: T136I

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T136I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,235,135 (GRCm39) F172I noncoding transcript Het
Aatk A G 11: 119,907,241 (GRCm39) V154A probably damaging Het
Abca6 A C 11: 110,135,020 (GRCm39) V255G probably benign Het
Adam8 T C 7: 139,568,786 (GRCm39) K211E probably benign Het
Alg12 A G 15: 88,690,084 (GRCm39) V470A possibly damaging Het
Anks1b C A 10: 89,905,353 (GRCm39) H231Q probably damaging Het
Bcl2 T C 1: 106,640,528 (GRCm39) Y28C probably damaging Het
Bms1 G T 6: 118,395,411 (GRCm39) F45L probably damaging Het
Btd T A 14: 31,384,073 (GRCm39) F20I probably benign Het
C1rl T C 6: 124,470,844 (GRCm39) S51P probably benign Het
Capn7 C A 14: 31,069,729 (GRCm39) F184L probably benign Het
Cd300lg A T 11: 101,932,390 (GRCm39) probably benign Het
Cdc34 T C 10: 79,518,362 (GRCm39) Y39H probably damaging Het
Cenpe A G 3: 134,935,851 (GRCm39) K429E probably damaging Het
Cfap43 T C 19: 47,784,114 (GRCm39) N473S probably benign Het
Cyfip1 A T 7: 55,574,175 (GRCm39) L1032F probably benign Het
Dach1 C T 14: 98,153,916 (GRCm39) V392I probably benign Het
Dnah14 C T 1: 181,484,598 (GRCm39) S1590L probably damaging Het
Dsp T C 13: 38,376,786 (GRCm39) Y1524H possibly damaging Het
Dusp13b T C 14: 21,797,549 (GRCm39) I103V possibly damaging Het
Eeig1 A G 2: 32,453,624 (GRCm39) T158A probably benign Het
Efhb T C 17: 53,707,874 (GRCm39) Y763C probably damaging Het
Fam117a G T 11: 95,227,965 (GRCm39) R25L unknown Het
Fcgbp T C 7: 27,791,174 (GRCm39) S812P possibly damaging Het
Fgd5 T A 6: 91,964,965 (GRCm39) N399K probably benign Het
Foxi3 T A 6: 70,934,017 (GRCm39) I168N probably damaging Het
Frem2 A T 3: 53,562,761 (GRCm39) I582K possibly damaging Het
Gm21915 T A 9: 40,582,266 (GRCm39) S120T probably benign Het
Gtf3c5 A G 2: 28,460,429 (GRCm39) probably null Het
Hecw1 A T 13: 14,422,286 (GRCm39) probably null Het
Hsf2 T A 10: 57,381,290 (GRCm39) Y293* probably null Het
Ints10 T A 8: 69,255,603 (GRCm39) Y198N probably damaging Het
Iqgap3 A G 3: 88,001,957 (GRCm39) E399G probably damaging Het
Itsn1 T A 16: 91,645,597 (GRCm39) probably null Het
Kcnh8 T C 17: 53,285,122 (GRCm39) S1031P probably damaging Het
Llgl1 A G 11: 60,597,387 (GRCm39) T279A probably benign Het
Ly6a C T 15: 74,868,300 (GRCm39) probably null Het
Marchf4 T C 1: 72,573,998 (GRCm39) E100G probably damaging Het
Mta1 A G 12: 113,084,456 (GRCm39) E84G probably benign Het
Myh7b A G 2: 155,467,886 (GRCm39) Y808C probably benign Het
Ncoa1 A G 12: 4,317,858 (GRCm39) V1158A possibly damaging Het
Npepps A G 11: 97,126,977 (GRCm39) S428P probably damaging Het
Onecut2 A T 18: 64,473,931 (GRCm39) T161S possibly damaging Het
Or10j27 C T 1: 172,958,383 (GRCm39) V134I probably benign Het
Or52e19b G A 7: 103,033,071 (GRCm39) T46I probably benign Het
Or6c5 T G 10: 129,074,747 (GRCm39) M243R probably benign Het
Pdp2 A G 8: 105,321,687 (GRCm39) D512G probably damaging Het
Pex11b G T 3: 96,551,027 (GRCm39) V171L probably benign Het
Potefam2 T C 7: 62,432,783 (GRCm39) probably null Het
Ppil3 A T 1: 58,480,078 (GRCm39) C32* probably null Het
Prune2 T C 19: 17,095,656 (GRCm39) Y387H probably damaging Het
Rbp3 C A 14: 33,677,605 (GRCm39) H518N possibly damaging Het
Rhot2 T C 17: 26,063,068 (GRCm39) Y58C probably damaging Het
Sec16b C A 1: 157,362,981 (GRCm39) H271N probably damaging Het
Sgo2a A G 1: 58,056,252 (GRCm39) D812G possibly damaging Het
Skap2 T C 6: 51,884,878 (GRCm39) E261G probably damaging Het
Spata31d1b A G 13: 59,865,117 (GRCm39) N755S probably benign Het
Stat5a T A 11: 100,767,689 (GRCm39) M419K probably damaging Het
Tecta C T 9: 42,270,465 (GRCm39) C1281Y probably damaging Het
Tm9sf2 T G 14: 122,374,913 (GRCm39) S196R probably benign Het
Trpm8 A T 1: 88,292,837 (GRCm39) H946L probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTAGAGTGTAGGCTTTCAGTG -3'
(R):5'- TTGTGCTTGACAGTCACTTAGAAG -3'

Sequencing Primer
(F):5'- GAAGAGCGCCAAGTGTTCTTATCC -3'
(R):5'- AAGTAAATCAATCTTTTGGGGGCG -3'
Posted On 2020-07-13