Incidental Mutation 'R8176:Pdp2'
ID634347
Institutional Source Beutler Lab
Gene Symbol Pdp2
Ensembl Gene ENSMUSG00000048371
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 2
Synonyms4833426J09Rik, LOC382051
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8176 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location104591451-104599026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104595055 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 512 (D512G)
Ref Sequence ENSEMBL: ENSMUSP00000092821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059588]
Predicted Effect probably damaging
Transcript: ENSMUST00000059588
AA Change: D512G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: D512G

DomainStartEndE-ValueType
PP2Cc 96 518 1.1e-92 SMART
PP2C_SIG 121 520 2.56e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,185,136 F172I noncoding transcript Het
A26c2 T C 7: 62,783,035 probably null Het
Aatk A G 11: 120,016,415 V154A probably damaging Het
Abca6 A C 11: 110,244,194 V255G probably benign Het
Adam8 T C 7: 139,988,873 K211E probably benign Het
Alg12 A G 15: 88,805,881 V470A possibly damaging Het
Anks1b C A 10: 90,069,491 H231Q probably damaging Het
Bcl2 T C 1: 106,712,798 Y28C probably damaging Het
Bms1 G T 6: 118,418,450 F45L probably damaging Het
Btd T A 14: 31,662,116 F20I probably benign Het
C1rl T C 6: 124,493,885 S51P probably benign Het
Capn7 C A 14: 31,347,772 F184L probably benign Het
Cd300lg A T 11: 102,041,564 probably benign Het
Cdc34 T C 10: 79,682,528 Y39H probably damaging Het
Cenpe A G 3: 135,230,090 K429E probably damaging Het
Cfap43 T C 19: 47,795,675 N473S probably benign Het
Cntln C T 4: 84,888,689 T136I probably damaging Het
Cyfip1 A T 7: 55,924,427 L1032F probably benign Het
Dach1 C T 14: 97,916,480 V392I probably benign Het
Dnah14 C T 1: 181,657,033 S1590L probably damaging Het
Dsp T C 13: 38,192,810 Y1524H possibly damaging Het
Dusp13 T C 14: 21,747,481 I103V possibly damaging Het
Efhb T C 17: 53,400,846 Y763C probably damaging Het
Fam102a A G 2: 32,563,612 T158A probably benign Het
Fam117a G T 11: 95,337,139 R25L unknown Het
Fcgbp T C 7: 28,091,749 S812P possibly damaging Het
Fgd5 T A 6: 91,987,984 N399K probably benign Het
Foxi3 T A 6: 70,957,033 I168N probably damaging Het
Frem2 A T 3: 53,655,340 I582K possibly damaging Het
Gm21915 T A 9: 40,670,970 S120T probably benign Het
Gtf3c5 A G 2: 28,570,417 probably null Het
Hecw1 A T 13: 14,247,701 probably null Het
Hsf2 T A 10: 57,505,194 Y293* probably null Het
Ints10 T A 8: 68,802,951 Y198N probably damaging Het
Iqgap3 A G 3: 88,094,650 E399G probably damaging Het
Itsn1 T A 16: 91,848,709 probably null Het
Kcnh8 T C 17: 52,978,094 S1031P probably damaging Het
Llgl1 A G 11: 60,706,561 T279A probably benign Het
Ly6a C T 15: 74,996,451 probably null Het
March4 T C 1: 72,534,839 E100G probably damaging Het
Mta1 A G 12: 113,120,836 E84G probably benign Het
Myh7b A G 2: 155,625,966 Y808C probably benign Het
Ncoa1 A G 12: 4,267,858 V1158A possibly damaging Het
Npepps A G 11: 97,236,151 S428P probably damaging Het
Olfr1408 C T 1: 173,130,816 V134I probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr774 T G 10: 129,238,878 M243R probably benign Het
Onecut2 A T 18: 64,340,860 T161S possibly damaging Het
Pex11b G T 3: 96,643,711 V171L probably benign Het
Ppil3 A T 1: 58,440,919 C32* probably null Het
Prune2 T C 19: 17,118,292 Y387H probably damaging Het
Rbp3 C A 14: 33,955,648 H518N possibly damaging Het
Rhot2 T C 17: 25,844,094 Y58C probably damaging Het
Sec16b C A 1: 157,535,411 H271N probably damaging Het
Sgol2a A G 1: 58,017,093 D812G possibly damaging Het
Skap2 T C 6: 51,907,898 E261G probably damaging Het
Spata31d1b A G 13: 59,717,303 N755S probably benign Het
Stat5a T A 11: 100,876,863 M419K probably damaging Het
Tecta C T 9: 42,359,169 C1281Y probably damaging Het
Tm9sf2 T G 14: 122,137,501 S196R probably benign Het
Trpm8 A T 1: 88,365,115 H946L probably benign Het
Other mutations in Pdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pdp2 APN 8 104594197 missense probably benign
IGL01771:Pdp2 APN 8 104594122 missense probably benign 0.06
IGL01946:Pdp2 APN 8 104594192 missense probably benign 0.00
IGL02313:Pdp2 APN 8 104594899 missense probably benign 0.44
IGL02588:Pdp2 APN 8 104594904 missense possibly damaging 0.73
IGL02981:Pdp2 APN 8 104593635 missense probably benign 0.00
R0456:Pdp2 UTSW 8 104593789 missense probably damaging 1.00
R1260:Pdp2 UTSW 8 104594617 missense probably damaging 0.96
R1974:Pdp2 UTSW 8 104593906 missense probably benign
R3008:Pdp2 UTSW 8 104594266 missense probably benign 0.08
R4580:Pdp2 UTSW 8 104594944 missense probably damaging 1.00
R4655:Pdp2 UTSW 8 104594536 missense probably benign 0.03
R5677:Pdp2 UTSW 8 104594688 missense probably damaging 1.00
R6813:Pdp2 UTSW 8 104594499 missense probably damaging 1.00
R8472:Pdp2 UTSW 8 104594281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAAGTTCCTGGTGCTGGCC -3'
(R):5'- ACTCAGCAACCTATGTCTGCC -3'

Sequencing Primer
(F):5'- TCCAAGGTGGGTCGCCATAAG -3'
(R):5'- AGCAACCTATGTCTGCCTATTC -3'
Posted On2020-07-13