Incidental Mutation 'R8176:Tecta'
ID634349
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8176 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42359169 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1281 (C1281Y)
Ref Sequence ENSEMBL: ENSMUSP00000040262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: C1281Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: C1281Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: C1281Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: C1281Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,185,136 F172I noncoding transcript Het
A26c2 T C 7: 62,783,035 probably null Het
Aatk A G 11: 120,016,415 V154A probably damaging Het
Abca6 A C 11: 110,244,194 V255G probably benign Het
Adam8 T C 7: 139,988,873 K211E probably benign Het
Alg12 A G 15: 88,805,881 V470A possibly damaging Het
Anks1b C A 10: 90,069,491 H231Q probably damaging Het
Bcl2 T C 1: 106,712,798 Y28C probably damaging Het
Bms1 G T 6: 118,418,450 F45L probably damaging Het
Btd T A 14: 31,662,116 F20I probably benign Het
C1rl T C 6: 124,493,885 S51P probably benign Het
Capn7 C A 14: 31,347,772 F184L probably benign Het
Cd300lg A T 11: 102,041,564 probably benign Het
Cdc34 T C 10: 79,682,528 Y39H probably damaging Het
Cenpe A G 3: 135,230,090 K429E probably damaging Het
Cfap43 T C 19: 47,795,675 N473S probably benign Het
Cntln C T 4: 84,888,689 T136I probably damaging Het
Cyfip1 A T 7: 55,924,427 L1032F probably benign Het
Dach1 C T 14: 97,916,480 V392I probably benign Het
Dnah14 C T 1: 181,657,033 S1590L probably damaging Het
Dsp T C 13: 38,192,810 Y1524H possibly damaging Het
Dusp13 T C 14: 21,747,481 I103V possibly damaging Het
Efhb T C 17: 53,400,846 Y763C probably damaging Het
Fam102a A G 2: 32,563,612 T158A probably benign Het
Fam117a G T 11: 95,337,139 R25L unknown Het
Fcgbp T C 7: 28,091,749 S812P possibly damaging Het
Fgd5 T A 6: 91,987,984 N399K probably benign Het
Foxi3 T A 6: 70,957,033 I168N probably damaging Het
Frem2 A T 3: 53,655,340 I582K possibly damaging Het
Gm21915 T A 9: 40,670,970 S120T probably benign Het
Gtf3c5 A G 2: 28,570,417 probably null Het
Hecw1 A T 13: 14,247,701 probably null Het
Hsf2 T A 10: 57,505,194 Y293* probably null Het
Ints10 T A 8: 68,802,951 Y198N probably damaging Het
Iqgap3 A G 3: 88,094,650 E399G probably damaging Het
Itsn1 T A 16: 91,848,709 probably null Het
Kcnh8 T C 17: 52,978,094 S1031P probably damaging Het
Llgl1 A G 11: 60,706,561 T279A probably benign Het
Ly6a C T 15: 74,996,451 probably null Het
March4 T C 1: 72,534,839 E100G probably damaging Het
Mta1 A G 12: 113,120,836 E84G probably benign Het
Myh7b A G 2: 155,625,966 Y808C probably benign Het
Ncoa1 A G 12: 4,267,858 V1158A possibly damaging Het
Npepps A G 11: 97,236,151 S428P probably damaging Het
Olfr1408 C T 1: 173,130,816 V134I probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr774 T G 10: 129,238,878 M243R probably benign Het
Onecut2 A T 18: 64,340,860 T161S possibly damaging Het
Pdp2 A G 8: 104,595,055 D512G probably damaging Het
Pex11b G T 3: 96,643,711 V171L probably benign Het
Ppil3 A T 1: 58,440,919 C32* probably null Het
Prune2 T C 19: 17,118,292 Y387H probably damaging Het
Rbp3 C A 14: 33,955,648 H518N possibly damaging Het
Rhot2 T C 17: 25,844,094 Y58C probably damaging Het
Sec16b C A 1: 157,535,411 H271N probably damaging Het
Sgol2a A G 1: 58,017,093 D812G possibly damaging Het
Skap2 T C 6: 51,907,898 E261G probably damaging Het
Spata31d1b A G 13: 59,717,303 N755S probably benign Het
Stat5a T A 11: 100,876,863 M419K probably damaging Het
Tm9sf2 T G 14: 122,137,501 S196R probably benign Het
Trpm8 A T 1: 88,365,115 H946L probably benign Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
R7343:Tecta UTSW 9 42337332 missense probably damaging 1.00
R7355:Tecta UTSW 9 42367142 nonsense probably null
R7635:Tecta UTSW 9 42330987 missense probably benign 0.11
R7653:Tecta UTSW 9 42337236 missense probably damaging 1.00
R7723:Tecta UTSW 9 42366936 missense probably damaging 1.00
R7939:Tecta UTSW 9 42388223 missense probably damaging 0.99
R7966:Tecta UTSW 9 42394962 missense probably damaging 0.98
R7967:Tecta UTSW 9 42377955 missense possibly damaging 0.95
R8000:Tecta UTSW 9 42367184 nonsense probably null
R8064:Tecta UTSW 9 42394955 missense possibly damaging 0.94
R8117:Tecta UTSW 9 42377631 missense probably damaging 1.00
R8284:Tecta UTSW 9 42378029 missense possibly damaging 0.89
R8315:Tecta UTSW 9 42387825 critical splice acceptor site probably null
R8321:Tecta UTSW 9 42373053 missense probably damaging 1.00
R8332:Tecta UTSW 9 42375014 missense probably damaging 1.00
R8437:Tecta UTSW 9 42332560 missense probably damaging 0.98
R8514:Tecta UTSW 9 42373110 missense probably damaging 0.99
Z1176:Tecta UTSW 9 42392094 missense probably damaging 0.99
Z1177:Tecta UTSW 9 42375576 missense probably benign 0.00
Z1177:Tecta UTSW 9 42392070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGTAACCAGCTGCAGGC -3'
(R):5'- GCCTGAAGGTCGTGTATGACTG -3'

Sequencing Primer
(F):5'- CTGTCTGCACGGCACCC -3'
(R):5'- CGTGTATGACTGGAAGACCTTC -3'
Posted On2020-07-13