Incidental Mutation 'R8176:Stat5a'
ID634357
Institutional Source Beutler Lab
Gene Symbol Stat5a
Ensembl Gene ENSMUSG00000004043
Gene Namesignal transducer and activator of transcription 5A
SynonymsSTAT5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8176 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100859351-100885169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100876863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 419 (M419K)
Ref Sequence ENSEMBL: ENSMUSP00000102980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000107356] [ENSMUST00000107357]
Predicted Effect probably damaging
Transcript: ENSMUST00000004145
AA Change: M419K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043
AA Change: M419K

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107356
AA Change: M419K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043
AA Change: M419K

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107357
AA Change: M419K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: M419K

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Meta Mutation Damage Score 0.8478 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,185,136 F172I noncoding transcript Het
A26c2 T C 7: 62,783,035 probably null Het
Aatk A G 11: 120,016,415 V154A probably damaging Het
Abca6 A C 11: 110,244,194 V255G probably benign Het
Adam8 T C 7: 139,988,873 K211E probably benign Het
Alg12 A G 15: 88,805,881 V470A possibly damaging Het
Anks1b C A 10: 90,069,491 H231Q probably damaging Het
Bcl2 T C 1: 106,712,798 Y28C probably damaging Het
Bms1 G T 6: 118,418,450 F45L probably damaging Het
Btd T A 14: 31,662,116 F20I probably benign Het
C1rl T C 6: 124,493,885 S51P probably benign Het
Capn7 C A 14: 31,347,772 F184L probably benign Het
Cd300lg A T 11: 102,041,564 probably benign Het
Cdc34 T C 10: 79,682,528 Y39H probably damaging Het
Cenpe A G 3: 135,230,090 K429E probably damaging Het
Cfap43 T C 19: 47,795,675 N473S probably benign Het
Cntln C T 4: 84,888,689 T136I probably damaging Het
Cyfip1 A T 7: 55,924,427 L1032F probably benign Het
Dach1 C T 14: 97,916,480 V392I probably benign Het
Dnah14 C T 1: 181,657,033 S1590L probably damaging Het
Dsp T C 13: 38,192,810 Y1524H possibly damaging Het
Dusp13 T C 14: 21,747,481 I103V possibly damaging Het
Efhb T C 17: 53,400,846 Y763C probably damaging Het
Fam102a A G 2: 32,563,612 T158A probably benign Het
Fam117a G T 11: 95,337,139 R25L unknown Het
Fcgbp T C 7: 28,091,749 S812P possibly damaging Het
Fgd5 T A 6: 91,987,984 N399K probably benign Het
Foxi3 T A 6: 70,957,033 I168N probably damaging Het
Frem2 A T 3: 53,655,340 I582K possibly damaging Het
Gm21915 T A 9: 40,670,970 S120T probably benign Het
Gtf3c5 A G 2: 28,570,417 probably null Het
Hecw1 A T 13: 14,247,701 probably null Het
Hsf2 T A 10: 57,505,194 Y293* probably null Het
Ints10 T A 8: 68,802,951 Y198N probably damaging Het
Iqgap3 A G 3: 88,094,650 E399G probably damaging Het
Itsn1 T A 16: 91,848,709 probably null Het
Kcnh8 T C 17: 52,978,094 S1031P probably damaging Het
Llgl1 A G 11: 60,706,561 T279A probably benign Het
Ly6a C T 15: 74,996,451 probably null Het
March4 T C 1: 72,534,839 E100G probably damaging Het
Mta1 A G 12: 113,120,836 E84G probably benign Het
Myh7b A G 2: 155,625,966 Y808C probably benign Het
Ncoa1 A G 12: 4,267,858 V1158A possibly damaging Het
Npepps A G 11: 97,236,151 S428P probably damaging Het
Olfr1408 C T 1: 173,130,816 V134I probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr774 T G 10: 129,238,878 M243R probably benign Het
Onecut2 A T 18: 64,340,860 T161S possibly damaging Het
Pdp2 A G 8: 104,595,055 D512G probably damaging Het
Pex11b G T 3: 96,643,711 V171L probably benign Het
Ppil3 A T 1: 58,440,919 C32* probably null Het
Prune2 T C 19: 17,118,292 Y387H probably damaging Het
Rbp3 C A 14: 33,955,648 H518N possibly damaging Het
Rhot2 T C 17: 25,844,094 Y58C probably damaging Het
Sec16b C A 1: 157,535,411 H271N probably damaging Het
Sgol2a A G 1: 58,017,093 D812G possibly damaging Het
Skap2 T C 6: 51,907,898 E261G probably damaging Het
Spata31d1b A G 13: 59,717,303 N755S probably benign Het
Tecta C T 9: 42,359,169 C1281Y probably damaging Het
Tm9sf2 T G 14: 122,137,501 S196R probably benign Het
Trpm8 A T 1: 88,365,115 H946L probably benign Het
Other mutations in Stat5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Stat5a APN 11 100881072 missense probably damaging 1.00
IGL02021:Stat5a APN 11 100883889 missense probably damaging 1.00
IGL02032:Stat5a APN 11 100861828 missense probably damaging 0.99
IGL03108:Stat5a APN 11 100863139 nonsense probably null
IGL03160:Stat5a APN 11 100861845 missense possibly damaging 0.71
hohum UTSW 11 100874129 missense probably damaging 1.00
R8176_stat5a_357 UTSW 11 100876863 missense probably damaging 1.00
yawn UTSW 11 100879693 missense possibly damaging 0.50
R0098:Stat5a UTSW 11 100875626 missense probably damaging 0.98
R0362:Stat5a UTSW 11 100882083 missense probably benign 0.01
R0452:Stat5a UTSW 11 100863135 missense probably benign 0.20
R0520:Stat5a UTSW 11 100861426 missense probably damaging 0.98
R0815:Stat5a UTSW 11 100875082 splice site probably null
R1081:Stat5a UTSW 11 100881060 missense probably damaging 1.00
R1752:Stat5a UTSW 11 100884058 makesense probably null
R1774:Stat5a UTSW 11 100879286 missense probably damaging 1.00
R1868:Stat5a UTSW 11 100874129 missense probably damaging 1.00
R2152:Stat5a UTSW 11 100874090 missense probably benign 0.38
R2900:Stat5a UTSW 11 100874131 missense probably benign 0.18
R4023:Stat5a UTSW 11 100874926 nonsense probably null
R4791:Stat5a UTSW 11 100865463 missense probably damaging 1.00
R5396:Stat5a UTSW 11 100880583 missense probably damaging 1.00
R5641:Stat5a UTSW 11 100876808 missense probably benign 0.01
R5723:Stat5a UTSW 11 100882074 missense probably benign 0.00
R5896:Stat5a UTSW 11 100877057 missense possibly damaging 0.94
R6026:Stat5a UTSW 11 100880316 missense probably damaging 1.00
R7052:Stat5a UTSW 11 100879285 missense probably damaging 1.00
R7075:Stat5a UTSW 11 100879693 missense possibly damaging 0.50
R7568:Stat5a UTSW 11 100875024 missense possibly damaging 0.74
R7771:Stat5a UTSW 11 100863219 missense probably benign 0.34
R7801:Stat5a UTSW 11 100880317 missense probably damaging 1.00
R7814:Stat5a UTSW 11 100875027 missense probably damaging 1.00
R7856:Stat5a UTSW 11 100883902 missense unknown
R8234:Stat5a UTSW 11 100879303 missense possibly damaging 0.59
R8680:Stat5a UTSW 11 100883888 missense unknown
R8923:Stat5a UTSW 11 100880482 missense
Predicted Primers PCR Primer
(F):5'- GATGGTCCCATTAGCAGCATGTC -3'
(R):5'- TGCCAACGCTGAACTGAGAC -3'

Sequencing Primer
(F):5'- ATTAGCAGCATGTCTCCCAGG -3'
(R):5'- GAGACTCAAACAGGACTGTGAACTTC -3'
Posted On2020-07-13