Incidental Mutation 'R8176:Mta1'
ID634363
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Namemetastasis associated 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8176 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113098278-113137206 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113120836 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
Predicted Effect probably benign
Transcript: ENSMUST00000009099
AA Change: E84G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: E84G

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069690
AA Change: E67G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: E67G

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109723
AA Change: E84G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: E84G

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109726
AA Change: E67G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: E67G

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109727
AA Change: E84G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: E84G

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik T A 12: 31,185,136 F172I noncoding transcript Het
A26c2 T C 7: 62,783,035 probably null Het
Aatk A G 11: 120,016,415 V154A probably damaging Het
Abca6 A C 11: 110,244,194 V255G probably benign Het
Adam8 T C 7: 139,988,873 K211E probably benign Het
Alg12 A G 15: 88,805,881 V470A possibly damaging Het
Anks1b C A 10: 90,069,491 H231Q probably damaging Het
Bcl2 T C 1: 106,712,798 Y28C probably damaging Het
Bms1 G T 6: 118,418,450 F45L probably damaging Het
Btd T A 14: 31,662,116 F20I probably benign Het
C1rl T C 6: 124,493,885 S51P probably benign Het
Capn7 C A 14: 31,347,772 F184L probably benign Het
Cd300lg A T 11: 102,041,564 probably benign Het
Cdc34 T C 10: 79,682,528 Y39H probably damaging Het
Cenpe A G 3: 135,230,090 K429E probably damaging Het
Cfap43 T C 19: 47,795,675 N473S probably benign Het
Cntln C T 4: 84,888,689 T136I probably damaging Het
Cyfip1 A T 7: 55,924,427 L1032F probably benign Het
Dach1 C T 14: 97,916,480 V392I probably benign Het
Dnah14 C T 1: 181,657,033 S1590L probably damaging Het
Dsp T C 13: 38,192,810 Y1524H possibly damaging Het
Dusp13 T C 14: 21,747,481 I103V possibly damaging Het
Efhb T C 17: 53,400,846 Y763C probably damaging Het
Fam102a A G 2: 32,563,612 T158A probably benign Het
Fam117a G T 11: 95,337,139 R25L unknown Het
Fcgbp T C 7: 28,091,749 S812P possibly damaging Het
Fgd5 T A 6: 91,987,984 N399K probably benign Het
Foxi3 T A 6: 70,957,033 I168N probably damaging Het
Frem2 A T 3: 53,655,340 I582K possibly damaging Het
Gm21915 T A 9: 40,670,970 S120T probably benign Het
Gtf3c5 A G 2: 28,570,417 probably null Het
Hecw1 A T 13: 14,247,701 probably null Het
Hsf2 T A 10: 57,505,194 Y293* probably null Het
Ints10 T A 8: 68,802,951 Y198N probably damaging Het
Iqgap3 A G 3: 88,094,650 E399G probably damaging Het
Itsn1 T A 16: 91,848,709 probably null Het
Kcnh8 T C 17: 52,978,094 S1031P probably damaging Het
Llgl1 A G 11: 60,706,561 T279A probably benign Het
Ly6a C T 15: 74,996,451 probably null Het
March4 T C 1: 72,534,839 E100G probably damaging Het
Myh7b A G 2: 155,625,966 Y808C probably benign Het
Ncoa1 A G 12: 4,267,858 V1158A possibly damaging Het
Npepps A G 11: 97,236,151 S428P probably damaging Het
Olfr1408 C T 1: 173,130,816 V134I probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr774 T G 10: 129,238,878 M243R probably benign Het
Onecut2 A T 18: 64,340,860 T161S possibly damaging Het
Pdp2 A G 8: 104,595,055 D512G probably damaging Het
Pex11b G T 3: 96,643,711 V171L probably benign Het
Ppil3 A T 1: 58,440,919 C32* probably null Het
Prune2 T C 19: 17,118,292 Y387H probably damaging Het
Rbp3 C A 14: 33,955,648 H518N possibly damaging Het
Rhot2 T C 17: 25,844,094 Y58C probably damaging Het
Sec16b C A 1: 157,535,411 H271N probably damaging Het
Sgol2a A G 1: 58,017,093 D812G possibly damaging Het
Skap2 T C 6: 51,907,898 E261G probably damaging Het
Spata31d1b A G 13: 59,717,303 N755S probably benign Het
Stat5a T A 11: 100,876,863 M419K probably damaging Het
Tecta C T 9: 42,359,169 C1281Y probably damaging Het
Tm9sf2 T G 14: 122,137,501 S196R probably benign Het
Trpm8 A T 1: 88,365,115 H946L probably benign Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 splice site probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
R7889:Mta1 UTSW 12 113131688 missense probably benign 0.02
R8136:Mta1 UTSW 12 113131678 missense probably damaging 1.00
R8385:Mta1 UTSW 12 113131465 missense probably benign
R8398:Mta1 UTSW 12 113131622 missense possibly damaging 0.83
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCTACATTGCAGGGTTCCAG -3'
(R):5'- TAACACTGCACTTGCCCCTG -3'

Sequencing Primer
(F):5'- TTGCAGGGTTCCAGGGCAC -3'
(R):5'- ACTTGCCCCTGGAAGAGAG -3'
Posted On2020-07-13