Incidental Mutation 'R8177:Sec23b'
ID634390
Institutional Source Beutler Lab
Gene Symbol Sec23b
Ensembl Gene ENSMUSG00000027429
Gene NameSEC23 homolog B, COPII coat complex component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8177 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location144556229-144590749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144585623 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 590 (P590L)
Ref Sequence ENSEMBL: ENSMUSP00000028916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028916]
Predicted Effect probably benign
Transcript: ENSMUST00000028916
AA Change: P590L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429
AA Change: P590L

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The function of this gene product has been implicated in cargo selection and concentration. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display complete neonatal lethality, fail to suckle, and show degeneration of the secretory tissues in the pancreas, salivary gland, and gastric glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,564 Y127* probably null Het
Abcb5 C T 12: 118,872,790 V1129I possibly damaging Het
Abcc2 A G 19: 43,807,080 D425G probably damaging Het
Adamts15 T A 9: 30,922,026 D71V probably damaging Het
Add1 A G 5: 34,616,705 H435R possibly damaging Het
AI464131 G T 4: 41,497,568 Y687* probably null Het
Akr1c19 A G 13: 4,242,592 N204S probably benign Het
Ankub1 C A 3: 57,690,416 R44S possibly damaging Het
Ano3 T A 2: 110,666,456 N783Y probably damaging Het
Bbs9 A G 9: 22,514,063 M138V probably benign Het
Ccdc18 G A 5: 108,197,795 E936K possibly damaging Het
Cit T G 5: 115,988,159 L1604V probably benign Het
Col2a1 T A 15: 97,976,773 S1396C unknown Het
Col3a1 G C 1: 45,335,764 G653R unknown Het
Col6a1 T C 10: 76,725,029 E45G probably damaging Het
Col9a3 T A 2: 180,607,657 F271I probably damaging Het
Cyp2g1 C A 7: 26,819,153 D364E probably damaging Het
Dmbt1 T A 7: 131,106,432 V1457D possibly damaging Het
Dnah17 A T 11: 118,128,927 I98N possibly damaging Het
Dyrk1b T A 7: 28,183,176 M222K possibly damaging Het
Epha8 T C 4: 136,945,663 D270G probably benign Het
Fbxw17 T C 13: 50,425,624 L159P probably damaging Het
Fgl2 G A 5: 21,373,309 probably null Het
Fmnl1 A T 11: 103,189,959 M309L probably damaging Het
Fn1 T C 1: 71,609,587 I1479V probably benign Het
Gm11939 A T 11: 99,559,298 S57T possibly damaging Het
Gm5415 T C 1: 32,546,376 E151G probably benign Het
Gm9195 C T 14: 72,460,537 A1268T possibly damaging Het
Gnpda1 A G 18: 38,333,295 W90R possibly damaging Het
Igkv5-43 T A 6: 69,823,461 R81W probably damaging Het
Mapk3 T A 7: 126,763,765 W230R probably null Het
Mplkip A G 13: 17,695,620 S46G probably benign Het
Mrs2 T C 13: 25,004,978 T118A probably benign Het
Mst1r T A 9: 107,907,585 H147Q probably damaging Het
Muc5ac G C 7: 141,807,331 G1460R probably damaging Het
Naip1 T C 13: 100,427,403 H418R probably benign Het
Ncapg A G 5: 45,693,753 T763A probably benign Het
Nr6a1 T C 2: 38,729,498 I462V probably benign Het
Nudcd3 T C 11: 6,193,460 D70G possibly damaging Het
Nup210 A G 6: 91,014,488 S1858P probably benign Het
Olfr1080 T A 2: 86,553,279 I282F noncoding transcript Het
Olfr1110 C A 2: 87,135,950 V124L possibly damaging Het
Olfr1148 T A 2: 87,833,168 I43N probably benign Het
Olfr2 G C 7: 107,001,456 L135V probably damaging Het
Olfr775 A G 10: 129,250,921 H129R probably benign Het
Pde4dip T C 3: 97,767,532 T23A probably damaging Het
Pex6 A G 17: 46,714,062 Q347R probably benign Het
Rbm27 A G 18: 42,324,110 K694R probably damaging Het
Rnf40 T G 7: 127,596,150 D549E probably benign Het
Rpl22 A G 4: 152,327,511 K15E probably damaging Het
Rsph6a T A 7: 19,074,239 D697E unknown Het
Slc17a7 T A 7: 45,174,932 M524K probably benign Het
Slc28a1 G A 7: 81,164,416 D454N probably benign Het
Slc6a13 C T 6: 121,325,028 R190* probably null Het
Slc7a9 G A 7: 35,456,133 V257I probably benign Het
Slco1a6 T A 6: 142,101,734 M377L probably damaging Het
Slit3 A G 11: 35,579,092 E307G probably damaging Het
Smchd1 A G 17: 71,390,453 M1164T probably benign Het
Stk4 T C 2: 164,088,857 I126T probably damaging Het
Syndig1 A T 2: 149,899,868 S125C probably damaging Het
Synm T C 7: 67,734,065 D1283G probably benign Het
Tmprss6 T C 15: 78,465,127 M73V probably benign Het
Tmprss9 A G 10: 80,895,048 I803V probably benign Het
Tmx4 A T 2: 134,643,902 V35E probably damaging Het
Topbp1 T G 9: 103,320,541 S440A probably benign Het
Twf1 T C 15: 94,584,395 I157V possibly damaging Het
Vmn1r205 T C 13: 22,592,245 N229S probably benign Het
Vmn1r27 T A 6: 58,215,774 I82L probably benign Het
Vmn2r112 A G 17: 22,603,613 N424S possibly damaging Het
Vmn2r68 A T 7: 85,222,214 Y620* probably null Het
Zfp51 A G 17: 21,463,867 D248G probably benign Het
Other mutations in Sec23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Sec23b APN 2 144583770 critical splice donor site probably null
IGL00668:Sec23b APN 2 144559218 utr 5 prime probably benign
IGL00714:Sec23b APN 2 144559225 missense probably benign 0.33
IGL00914:Sec23b APN 2 144566864 missense probably damaging 1.00
IGL01084:Sec23b APN 2 144564589 missense possibly damaging 0.81
IGL01341:Sec23b APN 2 144585733 missense probably benign 0.00
IGL01377:Sec23b APN 2 144559237 missense probably damaging 0.97
IGL01634:Sec23b APN 2 144559230 missense probably damaging 0.96
IGL02321:Sec23b APN 2 144579405 critical splice donor site probably null
IGL03027:Sec23b APN 2 144587545 missense possibly damaging 0.55
IGL03064:Sec23b APN 2 144582032 missense probably benign 0.00
IGL03105:Sec23b APN 2 144582020 missense probably damaging 1.00
IGL03240:Sec23b APN 2 144566759 splice site probably benign
R0004:Sec23b UTSW 2 144564562 splice site probably benign
R0092:Sec23b UTSW 2 144566910 missense probably benign 0.21
R0409:Sec23b UTSW 2 144567912 missense probably benign 0.22
R0426:Sec23b UTSW 2 144568612 unclassified probably benign
R0441:Sec23b UTSW 2 144581997 missense probably damaging 1.00
R1034:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R1624:Sec23b UTSW 2 144567129 missense probably benign
R2020:Sec23b UTSW 2 144566944 missense possibly damaging 0.49
R2392:Sec23b UTSW 2 144585587 splice site probably null
R3946:Sec23b UTSW 2 144581973 missense probably benign
R4407:Sec23b UTSW 2 144574718 missense possibly damaging 0.53
R4448:Sec23b UTSW 2 144559251 missense probably benign 0.43
R4519:Sec23b UTSW 2 144582015 missense possibly damaging 0.86
R4522:Sec23b UTSW 2 144578366 missense possibly damaging 0.80
R4654:Sec23b UTSW 2 144572574 missense probably benign 0.33
R4849:Sec23b UTSW 2 144585599 missense probably damaging 0.96
R4876:Sec23b UTSW 2 144586361 splice site probably null
R4983:Sec23b UTSW 2 144581953 missense probably benign 0.06
R6169:Sec23b UTSW 2 144586974 missense probably damaging 1.00
R6702:Sec23b UTSW 2 144559189 splice site probably null
R6703:Sec23b UTSW 2 144559189 splice site probably null
R6748:Sec23b UTSW 2 144566794 missense probably damaging 1.00
R7238:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R7511:Sec23b UTSW 2 144590349 missense probably benign 0.30
R7845:Sec23b UTSW 2 144559396 missense possibly damaging 0.67
R7914:Sec23b UTSW 2 144564645 missense probably benign
R8183:Sec23b UTSW 2 144559269 missense probably benign 0.08
R8238:Sec23b UTSW 2 144564648 missense probably benign 0.00
R8420:Sec23b UTSW 2 144559314 missense probably benign 0.01
R8488:Sec23b UTSW 2 144582063 missense probably damaging 0.98
R8558:Sec23b UTSW 2 144586388 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTGTGTCCAGTAGAAGGCAC -3'
(R):5'- ATGGCATTCTGAGGAAAGCGC -3'

Sequencing Primer
(F):5'- AGTAGAAGGCACTCTCTATTTCC -3'
(R):5'- AAAGCGCGTATGTCCGTTC -3'
Posted On2020-07-13