Incidental Mutation 'R8177:Stk4'
ID634392
Institutional Source Beutler Lab
Gene Symbol Stk4
Ensembl Gene ENSMUSG00000018209
Gene Nameserine/threonine kinase 4
SynonymsYsk3, sterile 20-like kinase 1, Kas-2, Mst1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8177 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164070322-164155524 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164088857 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 126 (I126T)
Ref Sequence ENSEMBL: ENSMUSP00000018353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018353] [ENSMUST00000134078]
Predicted Effect probably damaging
Transcript: ENSMUST00000018353
AA Change: I126T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209
AA Change: I126T

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134078
SMART Domains Protein: ENSMUSP00000122440
Gene: ENSMUSG00000018209

DomainStartEndE-ValueType
Pfam:Pkinase 29 113 7.2e-22 PFAM
Pfam:Pkinase_Tyr 29 113 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,564 Y127* probably null Het
Abcb5 C T 12: 118,872,790 V1129I possibly damaging Het
Abcc2 A G 19: 43,807,080 D425G probably damaging Het
Adamts15 T A 9: 30,922,026 D71V probably damaging Het
Add1 A G 5: 34,616,705 H435R possibly damaging Het
AI464131 G T 4: 41,497,568 Y687* probably null Het
Akr1c19 A G 13: 4,242,592 N204S probably benign Het
Ankub1 C A 3: 57,690,416 R44S possibly damaging Het
Ano3 T A 2: 110,666,456 N783Y probably damaging Het
Bbs9 A G 9: 22,514,063 M138V probably benign Het
Ccdc18 G A 5: 108,197,795 E936K possibly damaging Het
Cit T G 5: 115,988,159 L1604V probably benign Het
Col2a1 T A 15: 97,976,773 S1396C unknown Het
Col3a1 G C 1: 45,335,764 G653R unknown Het
Col6a1 T C 10: 76,725,029 E45G probably damaging Het
Col9a3 T A 2: 180,607,657 F271I probably damaging Het
Cyp2g1 C A 7: 26,819,153 D364E probably damaging Het
Dmbt1 T A 7: 131,106,432 V1457D possibly damaging Het
Dnah17 A T 11: 118,128,927 I98N possibly damaging Het
Dyrk1b T A 7: 28,183,176 M222K possibly damaging Het
Epha8 T C 4: 136,945,663 D270G probably benign Het
Fbxw17 T C 13: 50,425,624 L159P probably damaging Het
Fgl2 G A 5: 21,373,309 probably null Het
Fmnl1 A T 11: 103,189,959 M309L probably damaging Het
Fn1 T C 1: 71,609,587 I1479V probably benign Het
Gm11939 A T 11: 99,559,298 S57T possibly damaging Het
Gm5415 T C 1: 32,546,376 E151G probably benign Het
Gm9195 C T 14: 72,460,537 A1268T possibly damaging Het
Gnpda1 A G 18: 38,333,295 W90R possibly damaging Het
Igkv5-43 T A 6: 69,823,461 R81W probably damaging Het
Mapk3 T A 7: 126,763,765 W230R probably null Het
Mplkip A G 13: 17,695,620 S46G probably benign Het
Mrs2 T C 13: 25,004,978 T118A probably benign Het
Mst1r T A 9: 107,907,585 H147Q probably damaging Het
Muc5ac G C 7: 141,807,331 G1460R probably damaging Het
Naip1 T C 13: 100,427,403 H418R probably benign Het
Ncapg A G 5: 45,693,753 T763A probably benign Het
Nr6a1 T C 2: 38,729,498 I462V probably benign Het
Nudcd3 T C 11: 6,193,460 D70G possibly damaging Het
Nup210 A G 6: 91,014,488 S1858P probably benign Het
Olfr1080 T A 2: 86,553,279 I282F noncoding transcript Het
Olfr1110 C A 2: 87,135,950 V124L possibly damaging Het
Olfr1148 T A 2: 87,833,168 I43N probably benign Het
Olfr2 G C 7: 107,001,456 L135V probably damaging Het
Olfr775 A G 10: 129,250,921 H129R probably benign Het
Pde4dip T C 3: 97,767,532 T23A probably damaging Het
Pex6 A G 17: 46,714,062 Q347R probably benign Het
Rbm27 A G 18: 42,324,110 K694R probably damaging Het
Rnf40 T G 7: 127,596,150 D549E probably benign Het
Rpl22 A G 4: 152,327,511 K15E probably damaging Het
Rsph6a T A 7: 19,074,239 D697E unknown Het
Sec23b C T 2: 144,585,623 P590L probably benign Het
Slc17a7 T A 7: 45,174,932 M524K probably benign Het
Slc28a1 G A 7: 81,164,416 D454N probably benign Het
Slc6a13 C T 6: 121,325,028 R190* probably null Het
Slc7a9 G A 7: 35,456,133 V257I probably benign Het
Slco1a6 T A 6: 142,101,734 M377L probably damaging Het
Slit3 A G 11: 35,579,092 E307G probably damaging Het
Smchd1 A G 17: 71,390,453 M1164T probably benign Het
Syndig1 A T 2: 149,899,868 S125C probably damaging Het
Synm T C 7: 67,734,065 D1283G probably benign Het
Tmprss6 T C 15: 78,465,127 M73V probably benign Het
Tmprss9 A G 10: 80,895,048 I803V probably benign Het
Tmx4 A T 2: 134,643,902 V35E probably damaging Het
Topbp1 T G 9: 103,320,541 S440A probably benign Het
Twf1 T C 15: 94,584,395 I157V possibly damaging Het
Vmn1r205 T C 13: 22,592,245 N229S probably benign Het
Vmn1r27 T A 6: 58,215,774 I82L probably benign Het
Vmn2r112 A G 17: 22,603,613 N424S possibly damaging Het
Vmn2r68 A T 7: 85,222,214 Y620* probably null Het
Zfp51 A G 17: 21,463,867 D248G probably benign Het
Other mutations in Stk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
hallon UTSW 2 164099827 critical splice donor site probably null
iwo_jima UTSW 2 164088959 missense possibly damaging 0.94
ribeye UTSW 2 164079566 missense probably damaging 1.00
Sergeant UTSW 2 164099712 missense probably benign
stryker UTSW 2 164083688 nonsense probably null
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1972:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3155:Stk4 UTSW 2 164151743 missense probably benign 0.01
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5088:Stk4 UTSW 2 164083688 nonsense probably null
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
R7453:Stk4 UTSW 2 164086602 missense probably benign 0.01
R7698:Stk4 UTSW 2 164083743 missense probably damaging 1.00
R7726:Stk4 UTSW 2 164110226 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- AGCCTCAGGTAGATAGACCAG -3'
(R):5'- CACAGCCTACAGTACTGGTAC -3'

Sequencing Primer
(F):5'- CTCAGGTAGATAGACCAGGCAGG -3'
(R):5'- GGTACCAGTCACCACTTCC -3'
Posted On2020-07-13