Incidental Mutation 'R8177:Add1'
ID634400
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R8177 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34616705 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 435 (H435R)
Ref Sequence ENSEMBL: ENSMUSP00000109977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000052836] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000135321] [ENSMUST00000201810]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001108
AA Change: H435R

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106
AA Change: H435R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000052836
AA Change: H435R

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106
AA Change: H435R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114335
AA Change: H435R

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106
AA Change: H435R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114338
AA Change: H435R

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106
AA Change: H435R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114340
AA Change: H435R

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: H435R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135321
AA Change: H86R

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000152805
SMART Domains Protein: ENSMUSP00000121402
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 95 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201810
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,564 Y127* probably null Het
Abcb5 C T 12: 118,872,790 V1129I possibly damaging Het
Abcc2 A G 19: 43,807,080 D425G probably damaging Het
Adamts15 T A 9: 30,922,026 D71V probably damaging Het
AI464131 G T 4: 41,497,568 Y687* probably null Het
Akr1c19 A G 13: 4,242,592 N204S probably benign Het
Ankub1 C A 3: 57,690,416 R44S possibly damaging Het
Ano3 T A 2: 110,666,456 N783Y probably damaging Het
Bbs9 A G 9: 22,514,063 M138V probably benign Het
Ccdc18 G A 5: 108,197,795 E936K possibly damaging Het
Cit T G 5: 115,988,159 L1604V probably benign Het
Col2a1 T A 15: 97,976,773 S1396C unknown Het
Col3a1 G C 1: 45,335,764 G653R unknown Het
Col6a1 T C 10: 76,725,029 E45G probably damaging Het
Col9a3 T A 2: 180,607,657 F271I probably damaging Het
Cyp2g1 C A 7: 26,819,153 D364E probably damaging Het
Dmbt1 T A 7: 131,106,432 V1457D possibly damaging Het
Dnah17 A T 11: 118,128,927 I98N possibly damaging Het
Dyrk1b T A 7: 28,183,176 M222K possibly damaging Het
Epha8 T C 4: 136,945,663 D270G probably benign Het
Fbxw17 T C 13: 50,425,624 L159P probably damaging Het
Fgl2 G A 5: 21,373,309 probably null Het
Fmnl1 A T 11: 103,189,959 M309L probably damaging Het
Fn1 T C 1: 71,609,587 I1479V probably benign Het
Gm11939 A T 11: 99,559,298 S57T possibly damaging Het
Gm5415 T C 1: 32,546,376 E151G probably benign Het
Gm9195 C T 14: 72,460,537 A1268T possibly damaging Het
Gnpda1 A G 18: 38,333,295 W90R possibly damaging Het
Igkv5-43 T A 6: 69,823,461 R81W probably damaging Het
Mapk3 T A 7: 126,763,765 W230R probably null Het
Mplkip A G 13: 17,695,620 S46G probably benign Het
Mrs2 T C 13: 25,004,978 T118A probably benign Het
Mst1r T A 9: 107,907,585 H147Q probably damaging Het
Muc5ac G C 7: 141,807,331 G1460R probably damaging Het
Naip1 T C 13: 100,427,403 H418R probably benign Het
Ncapg A G 5: 45,693,753 T763A probably benign Het
Nr6a1 T C 2: 38,729,498 I462V probably benign Het
Nudcd3 T C 11: 6,193,460 D70G possibly damaging Het
Nup210 A G 6: 91,014,488 S1858P probably benign Het
Olfr1080 T A 2: 86,553,279 I282F noncoding transcript Het
Olfr1110 C A 2: 87,135,950 V124L possibly damaging Het
Olfr1148 T A 2: 87,833,168 I43N probably benign Het
Olfr2 G C 7: 107,001,456 L135V probably damaging Het
Olfr775 A G 10: 129,250,921 H129R probably benign Het
Pde4dip T C 3: 97,767,532 T23A probably damaging Het
Pex6 A G 17: 46,714,062 Q347R probably benign Het
Rbm27 A G 18: 42,324,110 K694R probably damaging Het
Rnf40 T G 7: 127,596,150 D549E probably benign Het
Rpl22 A G 4: 152,327,511 K15E probably damaging Het
Rsph6a T A 7: 19,074,239 D697E unknown Het
Sec23b C T 2: 144,585,623 P590L probably benign Het
Slc17a7 T A 7: 45,174,932 M524K probably benign Het
Slc28a1 G A 7: 81,164,416 D454N probably benign Het
Slc6a13 C T 6: 121,325,028 R190* probably null Het
Slc7a9 G A 7: 35,456,133 V257I probably benign Het
Slco1a6 T A 6: 142,101,734 M377L probably damaging Het
Slit3 A G 11: 35,579,092 E307G probably damaging Het
Smchd1 A G 17: 71,390,453 M1164T probably benign Het
Stk4 T C 2: 164,088,857 I126T probably damaging Het
Syndig1 A T 2: 149,899,868 S125C probably damaging Het
Synm T C 7: 67,734,065 D1283G probably benign Het
Tmprss6 T C 15: 78,465,127 M73V probably benign Het
Tmprss9 A G 10: 80,895,048 I803V probably benign Het
Tmx4 A T 2: 134,643,902 V35E probably damaging Het
Topbp1 T G 9: 103,320,541 S440A probably benign Het
Twf1 T C 15: 94,584,395 I157V possibly damaging Het
Vmn1r205 T C 13: 22,592,245 N229S probably benign Het
Vmn1r27 T A 6: 58,215,774 I82L probably benign Het
Vmn2r112 A G 17: 22,603,613 N424S possibly damaging Het
Vmn2r68 A T 7: 85,222,214 Y620* probably null Het
Zfp51 A G 17: 21,463,867 D248G probably benign Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 splice site probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0195:Add1 UTSW 5 34610646 unclassified probably benign
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2965:Add1 UTSW 5 34630714 missense probably benign 0.00
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5646:Add1 UTSW 5 34630680 missense probably benign 0.10
R5993:Add1 UTSW 5 34601533 missense probably damaging 1.00
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6514:Add1 UTSW 5 34605973 missense probably damaging 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
R6659:Add1 UTSW 5 34613295 missense possibly damaging 0.94
R7326:Add1 UTSW 5 34619371 missense probably benign 0.32
R7473:Add1 UTSW 5 34619353 missense possibly damaging 0.84
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCTTTGGATGCCACTCTG -3'
(R):5'- AATACAGCTTGGCACGCAG -3'

Sequencing Primer
(F):5'- AGATCTGGAGTGTGGACTGC -3'
(R):5'- CTTGGCACGCAGACACC -3'
Posted On2020-07-13