Incidental Mutation 'R8177:Cyp2g1'
ID 634410
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Name cytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
MMRRC Submission 067602-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26508352-26520622 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 26518578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 364 (D364E)
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
AlphaFold Q9WV19
Predicted Effect probably damaging
Transcript: ENSMUST00000040944
AA Change: D364E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685
AA Change: D364E

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,174 (GRCm39) Y127* probably null Het
Abcb5 C T 12: 118,836,525 (GRCm39) V1129I possibly damaging Het
Abcc2 A G 19: 43,795,519 (GRCm39) D425G probably damaging Het
Adamts15 T A 9: 30,833,322 (GRCm39) D71V probably damaging Het
Add1 A G 5: 34,774,049 (GRCm39) H435R possibly damaging Het
Akr1c19 A G 13: 4,292,591 (GRCm39) N204S probably benign Het
Ankub1 C A 3: 57,597,837 (GRCm39) R44S possibly damaging Het
Ano3 T A 2: 110,496,801 (GRCm39) N783Y probably damaging Het
Bbs9 A G 9: 22,425,359 (GRCm39) M138V probably benign Het
Ccdc18 G A 5: 108,345,661 (GRCm39) E936K possibly damaging Het
Cit T G 5: 116,126,218 (GRCm39) L1604V probably benign Het
Col2a1 T A 15: 97,874,654 (GRCm39) S1396C unknown Het
Col3a1 G C 1: 45,374,924 (GRCm39) G653R unknown Het
Col6a1 T C 10: 76,560,863 (GRCm39) E45G probably damaging Het
Col9a3 T A 2: 180,249,450 (GRCm39) F271I probably damaging Het
Dmbt1 T A 7: 130,708,162 (GRCm39) V1457D possibly damaging Het
Dnah17 A T 11: 118,019,753 (GRCm39) I98N possibly damaging Het
Dyrk1b T A 7: 27,882,601 (GRCm39) M222K possibly damaging Het
Epha8 T C 4: 136,672,974 (GRCm39) D270G probably benign Het
Fbxw17 T C 13: 50,579,660 (GRCm39) L159P probably damaging Het
Fgl2 G A 5: 21,578,307 (GRCm39) probably null Het
Fmnl1 A T 11: 103,080,785 (GRCm39) M309L probably damaging Het
Fn1 T C 1: 71,648,746 (GRCm39) I1479V probably benign Het
Gm11939 A T 11: 99,450,124 (GRCm39) S57T possibly damaging Het
Gm9195 C T 14: 72,697,977 (GRCm39) A1268T possibly damaging Het
Gnpda1 A G 18: 38,466,348 (GRCm39) W90R possibly damaging Het
Igkv5-43 T A 6: 69,800,445 (GRCm39) R81W probably damaging Het
Mapk3 T A 7: 126,362,937 (GRCm39) W230R probably null Het
Mplkip A G 13: 17,870,205 (GRCm39) S46G probably benign Het
Mrs2 T C 13: 25,188,961 (GRCm39) T118A probably benign Het
Mst1r T A 9: 107,784,784 (GRCm39) H147Q probably damaging Het
Muc5ac G C 7: 141,361,068 (GRCm39) G1460R probably damaging Het
Myorg G T 4: 41,497,568 (GRCm39) Y687* probably null Het
Naip1 T C 13: 100,563,911 (GRCm39) H418R probably benign Het
Ncapg A G 5: 45,851,095 (GRCm39) T763A probably benign Het
Nr6a1 T C 2: 38,619,510 (GRCm39) I462V probably benign Het
Nudcd3 T C 11: 6,143,460 (GRCm39) D70G possibly damaging Het
Nup210 A G 6: 90,991,470 (GRCm39) S1858P probably benign Het
Or12e13 T A 2: 87,663,512 (GRCm39) I43N probably benign Het
Or5aq1 C A 2: 86,966,294 (GRCm39) V124L possibly damaging Het
Or6a2 G C 7: 106,600,663 (GRCm39) L135V probably damaging Het
Or6c205 A G 10: 129,086,790 (GRCm39) H129R probably benign Het
Or8k33 T A 2: 86,383,623 (GRCm39) I282F noncoding transcript Het
Pde4dip T C 3: 97,674,848 (GRCm39) T23A probably damaging Het
Pex6 A G 17: 47,024,988 (GRCm39) Q347R probably benign Het
Rbm27 A G 18: 42,457,175 (GRCm39) K694R probably damaging Het
Rnf40 T G 7: 127,195,322 (GRCm39) D549E probably benign Het
Rpl22 A G 4: 152,411,968 (GRCm39) K15E probably damaging Het
Rsph6a T A 7: 18,808,164 (GRCm39) D697E unknown Het
Sec23b C T 2: 144,427,543 (GRCm39) P590L probably benign Het
Semp2l1 T C 1: 32,585,457 (GRCm39) E151G probably benign Het
Slc17a7 T A 7: 44,824,356 (GRCm39) M524K probably benign Het
Slc28a1 G A 7: 80,814,164 (GRCm39) D454N probably benign Het
Slc6a13 C T 6: 121,301,987 (GRCm39) R190* probably null Het
Slc7a9 G A 7: 35,155,558 (GRCm39) V257I probably benign Het
Slco1a6 T A 6: 142,047,460 (GRCm39) M377L probably damaging Het
Slit3 A G 11: 35,469,919 (GRCm39) E307G probably damaging Het
Smchd1 A G 17: 71,697,448 (GRCm39) M1164T probably benign Het
Stk4 T C 2: 163,930,777 (GRCm39) I126T probably damaging Het
Syndig1 A T 2: 149,741,788 (GRCm39) S125C probably damaging Het
Synm T C 7: 67,383,813 (GRCm39) D1283G probably benign Het
Tmprss6 T C 15: 78,349,327 (GRCm39) M73V probably benign Het
Tmprss9 A G 10: 80,730,882 (GRCm39) I803V probably benign Het
Tmx4 A T 2: 134,485,822 (GRCm39) V35E probably damaging Het
Topbp1 T G 9: 103,197,740 (GRCm39) S440A probably benign Het
Twf1 T C 15: 94,482,276 (GRCm39) I157V possibly damaging Het
Vmn1r205 T C 13: 22,776,415 (GRCm39) N229S probably benign Het
Vmn1r27 T A 6: 58,192,759 (GRCm39) I82L probably benign Het
Vmn2r112 A G 17: 22,822,594 (GRCm39) N424S possibly damaging Het
Vmn2r68 A T 7: 84,871,422 (GRCm39) Y620* probably null Het
Zfp51 A G 17: 21,684,129 (GRCm39) D248G probably benign Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26,509,256 (GRCm39) missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26,513,684 (GRCm39) missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26,513,719 (GRCm39) splice site probably benign
IGL02338:Cyp2g1 APN 7 26,514,229 (GRCm39) splice site probably benign
IGL02452:Cyp2g1 APN 7 26,510,871 (GRCm39) missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26,518,612 (GRCm39) missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26,509,201 (GRCm39) missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26,518,828 (GRCm39) missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26,513,619 (GRCm39) missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26,513,720 (GRCm39) splice site probably benign
R0697:Cyp2g1 UTSW 7 26,514,152 (GRCm39) nonsense probably null
R0830:Cyp2g1 UTSW 7 26,514,216 (GRCm39) missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26,509,107 (GRCm39) critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26,518,858 (GRCm39) missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26,520,135 (GRCm39) missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26,513,579 (GRCm39) missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26,520,226 (GRCm39) missense probably benign 0.06
R5574:Cyp2g1 UTSW 7 26,520,165 (GRCm39) missense possibly damaging 0.81
R5877:Cyp2g1 UTSW 7 26,516,065 (GRCm39) missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26,513,604 (GRCm39) missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26,520,184 (GRCm39) missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26,514,057 (GRCm39) missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26,518,618 (GRCm39) missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26,518,886 (GRCm39) missense probably benign
R8194:Cyp2g1 UTSW 7 26,514,159 (GRCm39) missense possibly damaging 0.89
R9043:Cyp2g1 UTSW 7 26,509,256 (GRCm39) missense probably benign 0.05
R9406:Cyp2g1 UTSW 7 26,518,910 (GRCm39) critical splice donor site probably null
R9441:Cyp2g1 UTSW 7 26,514,060 (GRCm39) missense possibly damaging 0.72
X0067:Cyp2g1 UTSW 7 26,520,187 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCAGAACATGGCTTGCTCTAAC -3'
(R):5'- ACATCTGTACCCTGGGAGAC -3'

Sequencing Primer
(F):5'- AGACATGTGGCTCATACCTG -3'
(R):5'- CAGACAGAGGCTATTAGAGTTCTGTG -3'
Posted On 2020-07-13