Mutagenetix > Incidental Mutation

Incidental Mutation 'R8177:Vmn2r68'

634416

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R8177 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 85222214 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 620 (Y620*)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably null
Transcript: ENSMUST00000061074
AA Change: Y620*

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: Y620*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9830107B12Rik	A	T	17: 48,128,564	Y127*	probably null	Het
Abcb5	C	T	12: 118,872,790	V1129I	possibly damaging	Het
Abcc2	A	G	19: 43,807,080	D425G	probably damaging	Het
Adamts15	T	A	9: 30,922,026	D71V	probably damaging	Het
Add1	A	G	5: 34,616,705	H435R	possibly damaging	Het
AI464131	G	T	4: 41,497,568	Y687*	probably null	Het
Akr1c19	A	G	13: 4,242,592	N204S	probably benign	Het
Ankub1	C	A	3: 57,690,416	R44S	possibly damaging	Het
Ano3	T	A	2: 110,666,456	N783Y	probably damaging	Het
Bbs9	A	G	9: 22,514,063	M138V	probably benign	Het
Ccdc18	G	A	5: 108,197,795	E936K	possibly damaging	Het
Cit	T	G	5: 115,988,159	L1604V	probably benign	Het
Col2a1	T	A	15: 97,976,773	S1396C	unknown	Het
Col3a1	G	C	1: 45,335,764	G653R	unknown	Het
Col6a1	T	C	10: 76,725,029	E45G	probably damaging	Het
Col9a3	T	A	2: 180,607,657	F271I	probably damaging	Het
Cyp2g1	C	A	7: 26,819,153	D364E	probably damaging	Het
Dmbt1	T	A	7: 131,106,432	V1457D	possibly damaging	Het
Dnah17	A	T	11: 118,128,927	I98N	possibly damaging	Het
Dyrk1b	T	A	7: 28,183,176	M222K	possibly damaging	Het
Epha8	T	C	4: 136,945,663	D270G	probably benign	Het
Fbxw17	T	C	13: 50,425,624	L159P	probably damaging	Het
Fgl2	G	A	5: 21,373,309		probably null	Het
Fmnl1	A	T	11: 103,189,959	M309L	probably damaging	Het
Fn1	T	C	1: 71,609,587	I1479V	probably benign	Het
Gm11939	A	T	11: 99,559,298	S57T	possibly damaging	Het
Gm5415	T	C	1: 32,546,376	E151G	probably benign	Het
Gm9195	C	T	14: 72,460,537	A1268T	possibly damaging	Het
Gnpda1	A	G	18: 38,333,295	W90R	possibly damaging	Het
Igkv5-43	T	A	6: 69,823,461	R81W	probably damaging	Het
Mapk3	T	A	7: 126,763,765	W230R	probably null	Het
Mplkip	A	G	13: 17,695,620	S46G	probably benign	Het
Mrs2	T	C	13: 25,004,978	T118A	probably benign	Het
Mst1r	T	A	9: 107,907,585	H147Q	probably damaging	Het
Muc5ac	G	C	7: 141,807,331	G1460R	probably damaging	Het
Naip1	T	C	13: 100,427,403	H418R	probably benign	Het
Ncapg	A	G	5: 45,693,753	T763A	probably benign	Het
Nr6a1	T	C	2: 38,729,498	I462V	probably benign	Het
Nudcd3	T	C	11: 6,193,460	D70G	possibly damaging	Het
Nup210	A	G	6: 91,014,488	S1858P	probably benign	Het
Olfr1080	T	A	2: 86,553,279	I282F	noncoding transcript	Het
Olfr1110	C	A	2: 87,135,950	V124L	possibly damaging	Het
Olfr1148	T	A	2: 87,833,168	I43N	probably benign	Het
Olfr2	G	C	7: 107,001,456	L135V	probably damaging	Het
Olfr775	A	G	10: 129,250,921	H129R	probably benign	Het
Pde4dip	T	C	3: 97,767,532	T23A	probably damaging	Het
Pex6	A	G	17: 46,714,062	Q347R	probably benign	Het
Rbm27	A	G	18: 42,324,110	K694R	probably damaging	Het
Rnf40	T	G	7: 127,596,150	D549E	probably benign	Het
Rpl22	A	G	4: 152,327,511	K15E	probably damaging	Het
Rsph6a	T	A	7: 19,074,239	D697E	unknown	Het
Sec23b	C	T	2: 144,585,623	P590L	probably benign	Het
Slc17a7	T	A	7: 45,174,932	M524K	probably benign	Het
Slc28a1	G	A	7: 81,164,416	D454N	probably benign	Het
Slc6a13	C	T	6: 121,325,028	R190*	probably null	Het
Slc7a9	G	A	7: 35,456,133	V257I	probably benign	Het
Slco1a6	T	A	6: 142,101,734	M377L	probably damaging	Het
Slit3	A	G	11: 35,579,092	E307G	probably damaging	Het
Smchd1	A	G	17: 71,390,453	M1164T	probably benign	Het
Stk4	T	C	2: 164,088,857	I126T	probably damaging	Het
Syndig1	A	T	2: 149,899,868	S125C	probably damaging	Het
Synm	T	C	7: 67,734,065	D1283G	probably benign	Het
Tmprss6	T	C	15: 78,465,127	M73V	probably benign	Het
Tmprss9	A	G	10: 80,895,048	I803V	probably benign	Het
Tmx4	A	T	2: 134,643,902	V35E	probably damaging	Het
Topbp1	T	G	9: 103,320,541	S440A	probably benign	Het
Twf1	T	C	15: 94,584,395	I157V	possibly damaging	Het
Vmn1r205	T	C	13: 22,592,245	N229S	probably benign	Het
Vmn1r27	T	A	6: 58,215,774	I82L	probably benign	Het
Vmn2r112	A	G	17: 22,603,613	N424S	possibly damaging	Het
Zfp51	A	G	17: 21,463,867	D248G	probably benign	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TATTTGGGTGCCCCTGACAC -3'
(R):5'- ATGCAAATGAACACCATACTCTCTG -3'

Sequencing Primer
(F):5'- GTGCCCCTGACACAAGCAG -3'
(R):5'- CTGCCTCCAAAAAGTTGTGTC -3'

Posted On

2020-07-13