Incidental Mutation 'R8177:Abcb5'
ID 634434
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B member 5
Synonyms 9230106F14Rik
MMRRC Submission 067602-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R8177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 118831559-118930156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118836525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1129 (V1129I)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect possibly damaging
Transcript: ENSMUST00000035515
AA Change: V1129I

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: V1129I

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,174 (GRCm39) Y127* probably null Het
Abcc2 A G 19: 43,795,519 (GRCm39) D425G probably damaging Het
Adamts15 T A 9: 30,833,322 (GRCm39) D71V probably damaging Het
Add1 A G 5: 34,774,049 (GRCm39) H435R possibly damaging Het
Akr1c19 A G 13: 4,292,591 (GRCm39) N204S probably benign Het
Ankub1 C A 3: 57,597,837 (GRCm39) R44S possibly damaging Het
Ano3 T A 2: 110,496,801 (GRCm39) N783Y probably damaging Het
Bbs9 A G 9: 22,425,359 (GRCm39) M138V probably benign Het
Ccdc18 G A 5: 108,345,661 (GRCm39) E936K possibly damaging Het
Cit T G 5: 116,126,218 (GRCm39) L1604V probably benign Het
Col2a1 T A 15: 97,874,654 (GRCm39) S1396C unknown Het
Col3a1 G C 1: 45,374,924 (GRCm39) G653R unknown Het
Col6a1 T C 10: 76,560,863 (GRCm39) E45G probably damaging Het
Col9a3 T A 2: 180,249,450 (GRCm39) F271I probably damaging Het
Cyp2g1 C A 7: 26,518,578 (GRCm39) D364E probably damaging Het
Dmbt1 T A 7: 130,708,162 (GRCm39) V1457D possibly damaging Het
Dnah17 A T 11: 118,019,753 (GRCm39) I98N possibly damaging Het
Dyrk1b T A 7: 27,882,601 (GRCm39) M222K possibly damaging Het
Epha8 T C 4: 136,672,974 (GRCm39) D270G probably benign Het
Fbxw17 T C 13: 50,579,660 (GRCm39) L159P probably damaging Het
Fgl2 G A 5: 21,578,307 (GRCm39) probably null Het
Fmnl1 A T 11: 103,080,785 (GRCm39) M309L probably damaging Het
Fn1 T C 1: 71,648,746 (GRCm39) I1479V probably benign Het
Gm11939 A T 11: 99,450,124 (GRCm39) S57T possibly damaging Het
Gm9195 C T 14: 72,697,977 (GRCm39) A1268T possibly damaging Het
Gnpda1 A G 18: 38,466,348 (GRCm39) W90R possibly damaging Het
Igkv5-43 T A 6: 69,800,445 (GRCm39) R81W probably damaging Het
Mapk3 T A 7: 126,362,937 (GRCm39) W230R probably null Het
Mplkip A G 13: 17,870,205 (GRCm39) S46G probably benign Het
Mrs2 T C 13: 25,188,961 (GRCm39) T118A probably benign Het
Mst1r T A 9: 107,784,784 (GRCm39) H147Q probably damaging Het
Muc5ac G C 7: 141,361,068 (GRCm39) G1460R probably damaging Het
Myorg G T 4: 41,497,568 (GRCm39) Y687* probably null Het
Naip1 T C 13: 100,563,911 (GRCm39) H418R probably benign Het
Ncapg A G 5: 45,851,095 (GRCm39) T763A probably benign Het
Nr6a1 T C 2: 38,619,510 (GRCm39) I462V probably benign Het
Nudcd3 T C 11: 6,143,460 (GRCm39) D70G possibly damaging Het
Nup210 A G 6: 90,991,470 (GRCm39) S1858P probably benign Het
Or12e13 T A 2: 87,663,512 (GRCm39) I43N probably benign Het
Or5aq1 C A 2: 86,966,294 (GRCm39) V124L possibly damaging Het
Or6a2 G C 7: 106,600,663 (GRCm39) L135V probably damaging Het
Or6c205 A G 10: 129,086,790 (GRCm39) H129R probably benign Het
Or8k33 T A 2: 86,383,623 (GRCm39) I282F noncoding transcript Het
Pde4dip T C 3: 97,674,848 (GRCm39) T23A probably damaging Het
Pex6 A G 17: 47,024,988 (GRCm39) Q347R probably benign Het
Rbm27 A G 18: 42,457,175 (GRCm39) K694R probably damaging Het
Rnf40 T G 7: 127,195,322 (GRCm39) D549E probably benign Het
Rpl22 A G 4: 152,411,968 (GRCm39) K15E probably damaging Het
Rsph6a T A 7: 18,808,164 (GRCm39) D697E unknown Het
Sec23b C T 2: 144,427,543 (GRCm39) P590L probably benign Het
Semp2l1 T C 1: 32,585,457 (GRCm39) E151G probably benign Het
Slc17a7 T A 7: 44,824,356 (GRCm39) M524K probably benign Het
Slc28a1 G A 7: 80,814,164 (GRCm39) D454N probably benign Het
Slc6a13 C T 6: 121,301,987 (GRCm39) R190* probably null Het
Slc7a9 G A 7: 35,155,558 (GRCm39) V257I probably benign Het
Slco1a6 T A 6: 142,047,460 (GRCm39) M377L probably damaging Het
Slit3 A G 11: 35,469,919 (GRCm39) E307G probably damaging Het
Smchd1 A G 17: 71,697,448 (GRCm39) M1164T probably benign Het
Stk4 T C 2: 163,930,777 (GRCm39) I126T probably damaging Het
Syndig1 A T 2: 149,741,788 (GRCm39) S125C probably damaging Het
Synm T C 7: 67,383,813 (GRCm39) D1283G probably benign Het
Tmprss6 T C 15: 78,349,327 (GRCm39) M73V probably benign Het
Tmprss9 A G 10: 80,730,882 (GRCm39) I803V probably benign Het
Tmx4 A T 2: 134,485,822 (GRCm39) V35E probably damaging Het
Topbp1 T G 9: 103,197,740 (GRCm39) S440A probably benign Het
Twf1 T C 15: 94,482,276 (GRCm39) I157V possibly damaging Het
Vmn1r205 T C 13: 22,776,415 (GRCm39) N229S probably benign Het
Vmn1r27 T A 6: 58,192,759 (GRCm39) I82L probably benign Het
Vmn2r112 A G 17: 22,822,594 (GRCm39) N424S possibly damaging Het
Vmn2r68 A T 7: 84,871,422 (GRCm39) Y620* probably null Het
Zfp51 A G 17: 21,684,129 (GRCm39) D248G probably benign Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118,854,345 (GRCm39) missense probably benign 0.03
IGL00092:Abcb5 APN 12 118,892,430 (GRCm39) missense probably benign 0.09
IGL00503:Abcb5 APN 12 118,871,336 (GRCm39) missense probably benign 0.02
IGL00776:Abcb5 APN 12 118,883,589 (GRCm39) missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118,849,911 (GRCm39) missense probably benign
IGL01302:Abcb5 APN 12 118,881,935 (GRCm39) missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118,836,602 (GRCm39) missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118,831,705 (GRCm39) missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118,875,169 (GRCm39) missense probably benign 0.03
IGL01784:Abcb5 APN 12 118,854,399 (GRCm39) missense probably benign 0.14
IGL01967:Abcb5 APN 12 118,831,707 (GRCm39) missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118,891,093 (GRCm39) missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118,904,415 (GRCm39) missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118,838,490 (GRCm39) missense probably benign
IGL02292:Abcb5 APN 12 118,881,932 (GRCm39) missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118,904,413 (GRCm39) missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118,870,003 (GRCm39) splice site probably benign
IGL02685:Abcb5 APN 12 118,869,682 (GRCm39) missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118,854,420 (GRCm39) missense probably benign 0.05
IGL02876:Abcb5 APN 12 118,883,576 (GRCm39) missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118,908,674 (GRCm39) missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118,904,104 (GRCm39) missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118,899,822 (GRCm39) missense probably benign 0.43
IGL03200:Abcb5 APN 12 118,928,989 (GRCm39) splice site probably benign
IGL03407:Abcb5 APN 12 118,904,111 (GRCm39) missense probably benign 0.01
alphabet UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
google UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118,899,833 (GRCm39) missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118,854,422 (GRCm39) missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118,891,129 (GRCm39) missense probably benign
R0219:Abcb5 UTSW 12 118,849,885 (GRCm39) splice site probably benign
R0312:Abcb5 UTSW 12 118,836,572 (GRCm39) missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118,928,986 (GRCm39) splice site probably benign
R0359:Abcb5 UTSW 12 118,904,067 (GRCm39) missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118,841,545 (GRCm39) missense probably benign 0.03
R0582:Abcb5 UTSW 12 118,904,147 (GRCm39) missense probably benign 0.40
R0815:Abcb5 UTSW 12 118,865,184 (GRCm39) splice site probably benign
R0900:Abcb5 UTSW 12 118,904,359 (GRCm39) missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118,869,933 (GRCm39) missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118,896,310 (GRCm39) missense probably benign 0.36
R1125:Abcb5 UTSW 12 118,875,282 (GRCm39) missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118,838,497 (GRCm39) missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118,929,064 (GRCm39) start gained probably benign
R1726:Abcb5 UTSW 12 118,871,267 (GRCm39) missense possibly damaging 0.95
R1726:Abcb5 UTSW 12 118,838,536 (GRCm39) splice site probably null
R1836:Abcb5 UTSW 12 118,831,696 (GRCm39) missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118,871,235 (GRCm39) splice site probably null
R1976:Abcb5 UTSW 12 118,854,417 (GRCm39) missense probably benign
R2005:Abcb5 UTSW 12 118,841,562 (GRCm39) missense probably benign 0.15
R2068:Abcb5 UTSW 12 118,904,303 (GRCm39) nonsense probably null
R2181:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118,831,691 (GRCm39) missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118,836,668 (GRCm39) missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118,838,355 (GRCm39) missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118,865,087 (GRCm39) splice site probably null
R3919:Abcb5 UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118,832,404 (GRCm39) missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118,836,657 (GRCm39) missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118,896,345 (GRCm39) critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118,929,040 (GRCm39) missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118,875,169 (GRCm39) missense probably benign 0.03
R4966:Abcb5 UTSW 12 118,850,626 (GRCm39) intron probably benign
R5169:Abcb5 UTSW 12 118,841,552 (GRCm39) nonsense probably null
R5327:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R5333:Abcb5 UTSW 12 118,831,677 (GRCm39) missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118,850,912 (GRCm39) missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118,875,234 (GRCm39) missense probably benign
R5416:Abcb5 UTSW 12 118,871,331 (GRCm39) missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118,891,061 (GRCm39) missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118,904,425 (GRCm39) missense probably null 1.00
R5566:Abcb5 UTSW 12 118,899,702 (GRCm39) missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118,896,348 (GRCm39) splice site probably null
R5691:Abcb5 UTSW 12 118,890,970 (GRCm39) missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118,881,992 (GRCm39) missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118,891,139 (GRCm39) missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118,832,516 (GRCm39) nonsense probably null
R5994:Abcb5 UTSW 12 118,928,995 (GRCm39) critical splice donor site probably null
R6295:Abcb5 UTSW 12 118,838,379 (GRCm39) missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118,854,284 (GRCm39) critical splice donor site probably null
R6609:Abcb5 UTSW 12 118,892,497 (GRCm39) missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118,908,641 (GRCm39) missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118,865,089 (GRCm39) splice site probably null
R6870:Abcb5 UTSW 12 118,929,000 (GRCm39) missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118,875,265 (GRCm39) missense probably benign 0.06
R6957:Abcb5 UTSW 12 118,871,270 (GRCm39) missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118,891,012 (GRCm39) missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118,895,660 (GRCm39) missense probably benign 0.00
R7061:Abcb5 UTSW 12 118,841,509 (GRCm39) missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118,831,611 (GRCm39) missense probably benign 0.00
R7239:Abcb5 UTSW 12 118,892,460 (GRCm39) missense probably benign 0.19
R7267:Abcb5 UTSW 12 118,916,205 (GRCm39) missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118,875,295 (GRCm39) missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118,831,609 (GRCm39) missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118,881,899 (GRCm39) missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R8296:Abcb5 UTSW 12 118,838,467 (GRCm39) missense probably benign 0.01
R8544:Abcb5 UTSW 12 118,832,461 (GRCm39) missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118,841,566 (GRCm39) missense probably benign 0.07
R8790:Abcb5 UTSW 12 118,831,620 (GRCm39) missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118,850,013 (GRCm39) missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118,895,651 (GRCm39) missense probably benign
R9410:Abcb5 UTSW 12 118,869,703 (GRCm39) missense probably benign 0.00
R9497:Abcb5 UTSW 12 118,899,850 (GRCm39) missense probably damaging 0.96
R9666:Abcb5 UTSW 12 118,838,422 (GRCm39) missense probably damaging 0.98
R9682:Abcb5 UTSW 12 118,896,328 (GRCm39) missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118,881,873 (GRCm39) missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118,882,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATTACATATGAATGGCTGG -3'
(R):5'- GTGTAACATGACACGGTTGTTATC -3'

Sequencing Primer
(F):5'- GCATTACATATGAATGGCTGGCTAGC -3'
(R):5'- GACACGGTTGTTATCAAACTAGTCTC -3'
Posted On 2020-07-13