Incidental Mutation 'R8177:Fbxw17'
ID634439
Institutional Source Beutler Lab
Gene Symbol Fbxw17
Ensembl Gene ENSMUSG00000037816
Gene NameF-box and WD-40 domain protein 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8177 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location50417864-50433780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50425624 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 159 (L159P)
Ref Sequence ENSEMBL: ENSMUSP00000041750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046974] [ENSMUST00000176479] [ENSMUST00000176913]
Predicted Effect probably damaging
Transcript: ENSMUST00000046974
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041750
Gene: ENSMUSG00000037816
AA Change: L159P

DomainStartEndE-ValueType
Pfam:F-box 3 47 1.4e-6 PFAM
Pfam:F-box-like 4 48 6.7e-12 PFAM
WD40 85 133 9.94e-1 SMART
Blast:WD40 136 175 6e-12 BLAST
WD40 369 408 1.07e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176479
Predicted Effect probably benign
Transcript: ENSMUST00000176913
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,564 Y127* probably null Het
Abcb5 C T 12: 118,872,790 V1129I possibly damaging Het
Abcc2 A G 19: 43,807,080 D425G probably damaging Het
Adamts15 T A 9: 30,922,026 D71V probably damaging Het
Add1 A G 5: 34,616,705 H435R possibly damaging Het
AI464131 G T 4: 41,497,568 Y687* probably null Het
Akr1c19 A G 13: 4,242,592 N204S probably benign Het
Ankub1 C A 3: 57,690,416 R44S possibly damaging Het
Ano3 T A 2: 110,666,456 N783Y probably damaging Het
Bbs9 A G 9: 22,514,063 M138V probably benign Het
Ccdc18 G A 5: 108,197,795 E936K possibly damaging Het
Cit T G 5: 115,988,159 L1604V probably benign Het
Col2a1 T A 15: 97,976,773 S1396C unknown Het
Col3a1 G C 1: 45,335,764 G653R unknown Het
Col6a1 T C 10: 76,725,029 E45G probably damaging Het
Col9a3 T A 2: 180,607,657 F271I probably damaging Het
Cyp2g1 C A 7: 26,819,153 D364E probably damaging Het
Dmbt1 T A 7: 131,106,432 V1457D possibly damaging Het
Dnah17 A T 11: 118,128,927 I98N possibly damaging Het
Dyrk1b T A 7: 28,183,176 M222K possibly damaging Het
Epha8 T C 4: 136,945,663 D270G probably benign Het
Fgl2 G A 5: 21,373,309 probably null Het
Fmnl1 A T 11: 103,189,959 M309L probably damaging Het
Fn1 T C 1: 71,609,587 I1479V probably benign Het
Gm11939 A T 11: 99,559,298 S57T possibly damaging Het
Gm5415 T C 1: 32,546,376 E151G probably benign Het
Gm9195 C T 14: 72,460,537 A1268T possibly damaging Het
Gnpda1 A G 18: 38,333,295 W90R possibly damaging Het
Igkv5-43 T A 6: 69,823,461 R81W probably damaging Het
Mapk3 T A 7: 126,763,765 W230R probably null Het
Mplkip A G 13: 17,695,620 S46G probably benign Het
Mrs2 T C 13: 25,004,978 T118A probably benign Het
Mst1r T A 9: 107,907,585 H147Q probably damaging Het
Muc5ac G C 7: 141,807,331 G1460R probably damaging Het
Naip1 T C 13: 100,427,403 H418R probably benign Het
Ncapg A G 5: 45,693,753 T763A probably benign Het
Nr6a1 T C 2: 38,729,498 I462V probably benign Het
Nudcd3 T C 11: 6,193,460 D70G possibly damaging Het
Nup210 A G 6: 91,014,488 S1858P probably benign Het
Olfr1080 T A 2: 86,553,279 I282F noncoding transcript Het
Olfr1110 C A 2: 87,135,950 V124L possibly damaging Het
Olfr1148 T A 2: 87,833,168 I43N probably benign Het
Olfr2 G C 7: 107,001,456 L135V probably damaging Het
Olfr775 A G 10: 129,250,921 H129R probably benign Het
Pde4dip T C 3: 97,767,532 T23A probably damaging Het
Pex6 A G 17: 46,714,062 Q347R probably benign Het
Rbm27 A G 18: 42,324,110 K694R probably damaging Het
Rnf40 T G 7: 127,596,150 D549E probably benign Het
Rpl22 A G 4: 152,327,511 K15E probably damaging Het
Rsph6a T A 7: 19,074,239 D697E unknown Het
Sec23b C T 2: 144,585,623 P590L probably benign Het
Slc17a7 T A 7: 45,174,932 M524K probably benign Het
Slc28a1 G A 7: 81,164,416 D454N probably benign Het
Slc6a13 C T 6: 121,325,028 R190* probably null Het
Slc7a9 G A 7: 35,456,133 V257I probably benign Het
Slco1a6 T A 6: 142,101,734 M377L probably damaging Het
Slit3 A G 11: 35,579,092 E307G probably damaging Het
Smchd1 A G 17: 71,390,453 M1164T probably benign Het
Stk4 T C 2: 164,088,857 I126T probably damaging Het
Syndig1 A T 2: 149,899,868 S125C probably damaging Het
Synm T C 7: 67,734,065 D1283G probably benign Het
Tmprss6 T C 15: 78,465,127 M73V probably benign Het
Tmprss9 A G 10: 80,895,048 I803V probably benign Het
Tmx4 A T 2: 134,643,902 V35E probably damaging Het
Topbp1 T G 9: 103,320,541 S440A probably benign Het
Twf1 T C 15: 94,584,395 I157V possibly damaging Het
Vmn1r205 T C 13: 22,592,245 N229S probably benign Het
Vmn1r27 T A 6: 58,215,774 I82L probably benign Het
Vmn2r112 A G 17: 22,603,613 N424S possibly damaging Het
Vmn2r68 A T 7: 85,222,214 Y620* probably null Het
Zfp51 A G 17: 21,463,867 D248G probably benign Het
Other mutations in Fbxw17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Fbxw17 APN 13 50423300 missense possibly damaging 0.49
IGL02477:Fbxw17 APN 13 50423817 missense possibly damaging 0.68
R0364:Fbxw17 UTSW 13 50432441 missense possibly damaging 0.83
R0577:Fbxw17 UTSW 13 50431583 missense probably benign
R1709:Fbxw17 UTSW 13 50431657 missense probably benign 0.00
R1791:Fbxw17 UTSW 13 50425774 unclassified probably benign
R4811:Fbxw17 UTSW 13 50425633 missense probably benign 0.01
R5013:Fbxw17 UTSW 13 50432470 missense probably benign
R5153:Fbxw17 UTSW 13 50419861 missense probably damaging 1.00
R5233:Fbxw17 UTSW 13 50432354 intron probably benign
R5475:Fbxw17 UTSW 13 50425648 missense probably benign
R6146:Fbxw17 UTSW 13 50432512 missense probably benign 0.38
R6294:Fbxw17 UTSW 13 50423803 missense probably benign
R6644:Fbxw17 UTSW 13 50423219 missense probably damaging 1.00
R6798:Fbxw17 UTSW 13 50433264 splice site probably null
R7007:Fbxw17 UTSW 13 50423772 missense probably damaging 1.00
R7059:Fbxw17 UTSW 13 50432548 missense probably damaging 1.00
R7565:Fbxw17 UTSW 13 50433362 missense probably damaging 1.00
R7685:Fbxw17 UTSW 13 50425644 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGACTGGTAGAGTGGGC -3'
(R):5'- TCAGACTCTACTCACCATAGGGG -3'

Sequencing Primer
(F):5'- AGTGGGCCCAGGCAAAC -3'
(R):5'- CCATAGGGGTTCCTGAGAGC -3'
Posted On2020-07-13