Incidental Mutation 'R8177:Naip1'
ID 634440
Institutional Source Beutler Lab
Gene Symbol Naip1
Ensembl Gene ENSMUSG00000021640
Gene Name NLR family, apoptosis inhibitory protein 1
Synonyms Birc1a, D13Lsd1, Naip
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 100407764-100452869 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100427403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 418 (H418R)
Ref Sequence ENSEMBL: ENSMUSP00000022142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022142]
AlphaFold Q9QWK5
Predicted Effect probably benign
Transcript: ENSMUST00000022142
AA Change: H418R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: H418R

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.18e-20 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 7.82e-26 SMART
AAA 462 603 1.14e-2 SMART
low complexity region 908 919 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,564 Y127* probably null Het
Abcb5 C T 12: 118,872,790 V1129I possibly damaging Het
Abcc2 A G 19: 43,807,080 D425G probably damaging Het
Adamts15 T A 9: 30,922,026 D71V probably damaging Het
Add1 A G 5: 34,616,705 H435R possibly damaging Het
AI464131 G T 4: 41,497,568 Y687* probably null Het
Akr1c19 A G 13: 4,242,592 N204S probably benign Het
Ankub1 C A 3: 57,690,416 R44S possibly damaging Het
Ano3 T A 2: 110,666,456 N783Y probably damaging Het
Bbs9 A G 9: 22,514,063 M138V probably benign Het
Ccdc18 G A 5: 108,197,795 E936K possibly damaging Het
Cit T G 5: 115,988,159 L1604V probably benign Het
Col2a1 T A 15: 97,976,773 S1396C unknown Het
Col3a1 G C 1: 45,335,764 G653R unknown Het
Col6a1 T C 10: 76,725,029 E45G probably damaging Het
Col9a3 T A 2: 180,607,657 F271I probably damaging Het
Cyp2g1 C A 7: 26,819,153 D364E probably damaging Het
Dmbt1 T A 7: 131,106,432 V1457D possibly damaging Het
Dnah17 A T 11: 118,128,927 I98N possibly damaging Het
Dyrk1b T A 7: 28,183,176 M222K possibly damaging Het
Epha8 T C 4: 136,945,663 D270G probably benign Het
Fbxw17 T C 13: 50,425,624 L159P probably damaging Het
Fgl2 G A 5: 21,373,309 probably null Het
Fmnl1 A T 11: 103,189,959 M309L probably damaging Het
Fn1 T C 1: 71,609,587 I1479V probably benign Het
Gm11939 A T 11: 99,559,298 S57T possibly damaging Het
Gm5415 T C 1: 32,546,376 E151G probably benign Het
Gm9195 C T 14: 72,460,537 A1268T possibly damaging Het
Gnpda1 A G 18: 38,333,295 W90R possibly damaging Het
Igkv5-43 T A 6: 69,823,461 R81W probably damaging Het
Mapk3 T A 7: 126,763,765 W230R probably null Het
Mplkip A G 13: 17,695,620 S46G probably benign Het
Mrs2 T C 13: 25,004,978 T118A probably benign Het
Mst1r T A 9: 107,907,585 H147Q probably damaging Het
Muc5ac G C 7: 141,807,331 G1460R probably damaging Het
Ncapg A G 5: 45,693,753 T763A probably benign Het
Nr6a1 T C 2: 38,729,498 I462V probably benign Het
Nudcd3 T C 11: 6,193,460 D70G possibly damaging Het
Nup210 A G 6: 91,014,488 S1858P probably benign Het
Olfr1080 T A 2: 86,553,279 I282F noncoding transcript Het
Olfr1110 C A 2: 87,135,950 V124L possibly damaging Het
Olfr1148 T A 2: 87,833,168 I43N probably benign Het
Olfr2 G C 7: 107,001,456 L135V probably damaging Het
Olfr775 A G 10: 129,250,921 H129R probably benign Het
Pde4dip T C 3: 97,767,532 T23A probably damaging Het
Pex6 A G 17: 46,714,062 Q347R probably benign Het
Rbm27 A G 18: 42,324,110 K694R probably damaging Het
Rnf40 T G 7: 127,596,150 D549E probably benign Het
Rpl22 A G 4: 152,327,511 K15E probably damaging Het
Rsph6a T A 7: 19,074,239 D697E unknown Het
Sec23b C T 2: 144,585,623 P590L probably benign Het
Slc17a7 T A 7: 45,174,932 M524K probably benign Het
Slc28a1 G A 7: 81,164,416 D454N probably benign Het
Slc6a13 C T 6: 121,325,028 R190* probably null Het
Slc7a9 G A 7: 35,456,133 V257I probably benign Het
Slco1a6 T A 6: 142,101,734 M377L probably damaging Het
Slit3 A G 11: 35,579,092 E307G probably damaging Het
Smchd1 A G 17: 71,390,453 M1164T probably benign Het
Stk4 T C 2: 164,088,857 I126T probably damaging Het
Syndig1 A T 2: 149,899,868 S125C probably damaging Het
Synm T C 7: 67,734,065 D1283G probably benign Het
Tmprss6 T C 15: 78,465,127 M73V probably benign Het
Tmprss9 A G 10: 80,895,048 I803V probably benign Het
Tmx4 A T 2: 134,643,902 V35E probably damaging Het
Topbp1 T G 9: 103,320,541 S440A probably benign Het
Twf1 T C 15: 94,584,395 I157V possibly damaging Het
Vmn1r205 T C 13: 22,592,245 N229S probably benign Het
Vmn1r27 T A 6: 58,215,774 I82L probably benign Het
Vmn2r112 A G 17: 22,603,613 N424S possibly damaging Het
Vmn2r68 A T 7: 85,222,214 Y620* probably null Het
Zfp51 A G 17: 21,463,867 D248G probably benign Het
Other mutations in Naip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Naip1 APN 13 100443720 critical splice acceptor site probably null
IGL01145:Naip1 APN 13 100409121 missense probably benign 0.00
IGL01356:Naip1 APN 13 100423214 missense probably damaging 0.99
IGL01414:Naip1 APN 13 100409173 critical splice acceptor site probably null
IGL01505:Naip1 APN 13 100425933 missense probably damaging 1.00
IGL01573:Naip1 APN 13 100427382 missense probably benign 0.03
IGL01931:Naip1 APN 13 100409032 nonsense probably null
IGL02043:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02097:Naip1 APN 13 100425588 missense probably benign 0.03
IGL02331:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02627:Naip1 APN 13 100425648 missense possibly damaging 0.68
IGL02675:Naip1 APN 13 100409118 missense probably benign
IGL02801:Naip1 APN 13 100444368 missense probably damaging 1.00
IGL02851:Naip1 APN 13 100433262 missense probably damaging 1.00
IGL03038:Naip1 APN 13 100437333 nonsense probably null
IGL03399:Naip1 APN 13 100408918 missense probably damaging 1.00
FR4340:Naip1 UTSW 13 100423076 missense probably benign
FR4342:Naip1 UTSW 13 100425471 missense probably benign 0.00
R0051:Naip1 UTSW 13 100411001 missense probably damaging 0.96
R0095:Naip1 UTSW 13 100423083 missense probably benign 0.24
R0147:Naip1 UTSW 13 100426910 missense possibly damaging 0.67
R0375:Naip1 UTSW 13 100409148 missense probably benign 0.21
R0442:Naip1 UTSW 13 100444516 missense probably benign 0.00
R0455:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0491:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0614:Naip1 UTSW 13 100444200 missense probably benign 0.00
R0785:Naip1 UTSW 13 100423076 missense probably benign
R0785:Naip1 UTSW 13 100423085 missense probably benign 0.00
R0787:Naip1 UTSW 13 100426096 missense probably benign 0.22
R1081:Naip1 UTSW 13 100423070 missense probably benign 0.21
R1177:Naip1 UTSW 13 100427064 missense possibly damaging 0.91
R1476:Naip1 UTSW 13 100426870 missense probably benign 0.35
R1672:Naip1 UTSW 13 100423149 missense probably benign 0.00
R1809:Naip1 UTSW 13 100426239 missense probably benign
R2057:Naip1 UTSW 13 100425573 missense probably damaging 0.96
R2182:Naip1 UTSW 13 100413680 missense probably benign 0.01
R2395:Naip1 UTSW 13 100423106 missense possibly damaging 0.83
R2518:Naip1 UTSW 13 100423219 missense probably benign 0.00
R3033:Naip1 UTSW 13 100432458 missense probably benign 0.01
R3122:Naip1 UTSW 13 100408995 missense probably damaging 1.00
R3439:Naip1 UTSW 13 100423219 missense probably benign 0.00
R4167:Naip1 UTSW 13 100444286 missense probably benign 0.04
R4179:Naip1 UTSW 13 100426176 missense probably damaging 0.99
R4212:Naip1 UTSW 13 100426875 splice site probably null
R4639:Naip1 UTSW 13 100444283 missense probably benign 0.31
R4674:Naip1 UTSW 13 100444174 missense probably damaging 1.00
R4736:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4740:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4778:Naip1 UTSW 13 100426648 missense probably damaging 1.00
R4806:Naip1 UTSW 13 100425621 missense probably benign 0.00
R4855:Naip1 UTSW 13 100423220 splice site probably null
R5740:Naip1 UTSW 13 100432501 critical splice acceptor site probably null
R5797:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R5806:Naip1 UTSW 13 100444735 start codon destroyed probably null 1.00
R5895:Naip1 UTSW 13 100423128 missense probably benign 0.00
R5896:Naip1 UTSW 13 100423128 missense probably benign 0.00
R6023:Naip1 UTSW 13 100426186 missense probably benign 0.00
R6109:Naip1 UTSW 13 100427182 missense probably damaging 1.00
R6117:Naip1 UTSW 13 100444737 start codon destroyed probably damaging 0.99
R6133:Naip1 UTSW 13 100444643 missense probably benign 0.10
R6241:Naip1 UTSW 13 100425661 missense probably damaging 0.99
R6335:Naip1 UTSW 13 100426552 missense probably damaging 1.00
R6404:Naip1 UTSW 13 100423219 missense probably benign 0.00
R6475:Naip1 UTSW 13 100409088 missense probably damaging 1.00
R6508:Naip1 UTSW 13 100436465 missense probably damaging 1.00
R6580:Naip1 UTSW 13 100444649 missense probably damaging 0.99
R6600:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6600:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6603:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6603:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6633:Naip1 UTSW 13 100423076 missense probably benign
R6633:Naip1 UTSW 13 100423085 missense probably benign 0.00
R6720:Naip1 UTSW 13 100423077 missense probably benign 0.00
R6805:Naip1 UTSW 13 100427341 missense probably benign 0.04
R7043:Naip1 UTSW 13 100426914 missense probably damaging 1.00
R7615:Naip1 UTSW 13 100425776 missense probably benign 0.00
R7797:Naip1 UTSW 13 100444478 missense probably damaging 1.00
R7820:Naip1 UTSW 13 100423070 missense probably benign 0.21
R7842:Naip1 UTSW 13 100426998 missense probably damaging 1.00
R8117:Naip1 UTSW 13 100427001 missense possibly damaging 0.67
R8132:Naip1 UTSW 13 100437375 missense possibly damaging 0.84
R8203:Naip1 UTSW 13 100425820 missense probably benign 0.02
R8283:Naip1 UTSW 13 100427187 missense probably damaging 1.00
R8319:Naip1 UTSW 13 100429213 missense probably benign 0.13
R8377:Naip1 UTSW 13 100425866 missense possibly damaging 0.53
R8864:Naip1 UTSW 13 100426320 missense possibly damaging 0.55
R8871:Naip1 UTSW 13 100443638 missense probably damaging 1.00
R8987:Naip1 UTSW 13 100426926 missense probably damaging 1.00
R9079:Naip1 UTSW 13 100423219 missense probably benign 0.00
R9275:Naip1 UTSW 13 100426176 missense probably damaging 0.99
R9354:Naip1 UTSW 13 100427486 missense probably benign 0.31
R9524:Naip1 UTSW 13 100426593 missense probably benign 0.06
R9617:Naip1 UTSW 13 100433313 missense probably benign 0.01
R9776:Naip1 UTSW 13 100423076 missense probably benign
R9802:Naip1 UTSW 13 100426205 missense probably benign
RF007:Naip1 UTSW 13 100426134 missense probably benign 0.03
X0066:Naip1 UTSW 13 100437322 missense probably damaging 1.00
Y4335:Naip1 UTSW 13 100425522 missense probably benign 0.00
Y4336:Naip1 UTSW 13 100425522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGTTGTCTTTCCACTGCC -3'
(R):5'- TGATGCTATGAAAAGGTCTGGG -3'

Sequencing Primer
(F):5'- GGTTGTCTTTCCACTGCCAGTTTC -3'
(R):5'- TCTGGGAGGACCTCAGGTG -3'
Posted On 2020-07-13