Incidental Mutation 'R8177:Twf1'
ID634443
Institutional Source Beutler Lab
Gene Symbol Twf1
Ensembl Gene ENSMUSG00000022451
Gene Nametwinfilin actin binding protein 1
Synonymsactin monomer-binding protein, A6, Twinfilin-1, Ptk9, twinfilin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8177 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location94577951-94589889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94584395 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 157 (I157V)
Ref Sequence ENSEMBL: ENSMUSP00000023087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023087] [ENSMUST00000109248] [ENSMUST00000152590]
PDB Structure CRYSTAL STRUCTURE OF THE N-TERMINAL ADF-H DOMAIN OF MOUSE TWINFILIN ISOFORM-1 [X-RAY DIFFRACTION]
Solution structure of the second tandem cofilin-domain of mouse twinfilin [SOLUTION NMR]
Solution structure of C-teminal domain of twinfilin-1. [SOLUTION NMR]
Structure of the actin-depolymerizing factor homology domain in complex with actin [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023087
AA Change: I157V

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023087
Gene: ENSMUSG00000022451
AA Change: I157V

DomainStartEndE-ValueType
ADF 11 139 4.74e-35 SMART
ADF 184 313 6.22e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109248
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152590
SMART Domains Protein: ENSMUSP00000119302
Gene: ENSMUSG00000022451

DomainStartEndE-ValueType
ADF 1 113 1.9e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes twinfilin, an actin monomer-binding protein conserved from yeast to mammals. Studies of the mouse counterpart suggest that this protein may be an actin monomer-binding protein, and its localization to cortical G-actin-rich structures may be regulated by the small GTPase RAC1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,564 Y127* probably null Het
Abcb5 C T 12: 118,872,790 V1129I possibly damaging Het
Abcc2 A G 19: 43,807,080 D425G probably damaging Het
Adamts15 T A 9: 30,922,026 D71V probably damaging Het
Add1 A G 5: 34,616,705 H435R possibly damaging Het
AI464131 G T 4: 41,497,568 Y687* probably null Het
Akr1c19 A G 13: 4,242,592 N204S probably benign Het
Ankub1 C A 3: 57,690,416 R44S possibly damaging Het
Ano3 T A 2: 110,666,456 N783Y probably damaging Het
Bbs9 A G 9: 22,514,063 M138V probably benign Het
Ccdc18 G A 5: 108,197,795 E936K possibly damaging Het
Cit T G 5: 115,988,159 L1604V probably benign Het
Col2a1 T A 15: 97,976,773 S1396C unknown Het
Col3a1 G C 1: 45,335,764 G653R unknown Het
Col6a1 T C 10: 76,725,029 E45G probably damaging Het
Col9a3 T A 2: 180,607,657 F271I probably damaging Het
Cyp2g1 C A 7: 26,819,153 D364E probably damaging Het
Dmbt1 T A 7: 131,106,432 V1457D possibly damaging Het
Dnah17 A T 11: 118,128,927 I98N possibly damaging Het
Dyrk1b T A 7: 28,183,176 M222K possibly damaging Het
Epha8 T C 4: 136,945,663 D270G probably benign Het
Fbxw17 T C 13: 50,425,624 L159P probably damaging Het
Fgl2 G A 5: 21,373,309 probably null Het
Fmnl1 A T 11: 103,189,959 M309L probably damaging Het
Fn1 T C 1: 71,609,587 I1479V probably benign Het
Gm11939 A T 11: 99,559,298 S57T possibly damaging Het
Gm5415 T C 1: 32,546,376 E151G probably benign Het
Gm9195 C T 14: 72,460,537 A1268T possibly damaging Het
Gnpda1 A G 18: 38,333,295 W90R possibly damaging Het
Igkv5-43 T A 6: 69,823,461 R81W probably damaging Het
Mapk3 T A 7: 126,763,765 W230R probably null Het
Mplkip A G 13: 17,695,620 S46G probably benign Het
Mrs2 T C 13: 25,004,978 T118A probably benign Het
Mst1r T A 9: 107,907,585 H147Q probably damaging Het
Muc5ac G C 7: 141,807,331 G1460R probably damaging Het
Naip1 T C 13: 100,427,403 H418R probably benign Het
Ncapg A G 5: 45,693,753 T763A probably benign Het
Nr6a1 T C 2: 38,729,498 I462V probably benign Het
Nudcd3 T C 11: 6,193,460 D70G possibly damaging Het
Nup210 A G 6: 91,014,488 S1858P probably benign Het
Olfr1080 T A 2: 86,553,279 I282F noncoding transcript Het
Olfr1110 C A 2: 87,135,950 V124L possibly damaging Het
Olfr1148 T A 2: 87,833,168 I43N probably benign Het
Olfr2 G C 7: 107,001,456 L135V probably damaging Het
Olfr775 A G 10: 129,250,921 H129R probably benign Het
Pde4dip T C 3: 97,767,532 T23A probably damaging Het
Pex6 A G 17: 46,714,062 Q347R probably benign Het
Rbm27 A G 18: 42,324,110 K694R probably damaging Het
Rnf40 T G 7: 127,596,150 D549E probably benign Het
Rpl22 A G 4: 152,327,511 K15E probably damaging Het
Rsph6a T A 7: 19,074,239 D697E unknown Het
Sec23b C T 2: 144,585,623 P590L probably benign Het
Slc17a7 T A 7: 45,174,932 M524K probably benign Het
Slc28a1 G A 7: 81,164,416 D454N probably benign Het
Slc6a13 C T 6: 121,325,028 R190* probably null Het
Slc7a9 G A 7: 35,456,133 V257I probably benign Het
Slco1a6 T A 6: 142,101,734 M377L probably damaging Het
Slit3 A G 11: 35,579,092 E307G probably damaging Het
Smchd1 A G 17: 71,390,453 M1164T probably benign Het
Stk4 T C 2: 164,088,857 I126T probably damaging Het
Syndig1 A T 2: 149,899,868 S125C probably damaging Het
Synm T C 7: 67,734,065 D1283G probably benign Het
Tmprss6 T C 15: 78,465,127 M73V probably benign Het
Tmprss9 A G 10: 80,895,048 I803V probably benign Het
Tmx4 A T 2: 134,643,902 V35E probably damaging Het
Topbp1 T G 9: 103,320,541 S440A probably benign Het
Vmn1r205 T C 13: 22,592,245 N229S probably benign Het
Vmn1r27 T A 6: 58,215,774 I82L probably benign Het
Vmn2r112 A G 17: 22,603,613 N424S possibly damaging Het
Vmn2r68 A T 7: 85,222,214 Y620* probably null Het
Zfp51 A G 17: 21,463,867 D248G probably benign Het
Other mutations in Twf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Twf1 APN 15 94580936 unclassified probably benign
IGL02732:Twf1 APN 15 94581009 missense probably damaging 1.00
R0122:Twf1 UTSW 15 94586549 splice site probably benign
R0184:Twf1 UTSW 15 94581067 critical splice acceptor site probably null
R0507:Twf1 UTSW 15 94585530 missense probably damaging 1.00
R0742:Twf1 UTSW 15 94585530 missense probably damaging 1.00
R1200:Twf1 UTSW 15 94586358 missense probably benign 0.05
R1858:Twf1 UTSW 15 94585547 splice site probably benign
R2005:Twf1 UTSW 15 94585447 critical splice donor site probably null
R2290:Twf1 UTSW 15 94586519 missense probably damaging 0.98
R3732:Twf1 UTSW 15 94584414 unclassified probably benign
R4787:Twf1 UTSW 15 94584434 missense probably damaging 1.00
R7782:Twf1 UTSW 15 94582773 missense probably benign 0.05
R7893:Twf1 UTSW 15 94584446 missense probably benign 0.00
R8415:Twf1 UTSW 15 94579821 makesense probably null
R8729:Twf1 UTSW 15 94581331 missense probably benign
R8768:Twf1 UTSW 15 94581229 missense probably damaging 1.00
R8803:Twf1 UTSW 15 94581255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTTCTGAAAACACGTAAAGC -3'
(R):5'- GCAGTTGTTCTGAAGCCCTC -3'

Sequencing Primer
(F):5'- AGCACACAGATCAGTTTTTAACC -3'
(R):5'- GCGAGAGAGAAGCCTCCG -3'
Posted On2020-07-13