Incidental Mutation 'R8177:Pex6'
ID634447
Institutional Source Beutler Lab
Gene Symbol Pex6
Ensembl Gene ENSMUSG00000002763
Gene Nameperoxisomal biogenesis factor 6
SynonymsD130055I09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_145488; Ensembl: ENSMUSP00000002840

Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R8177 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46711463-46725541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46714062 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 347 (Q347R)
Ref Sequence ENSEMBL: ENSMUSP00000002840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
AA Change: Q347R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763
AA Change: Q347R

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,564 Y127* probably null Het
Abcb5 C T 12: 118,872,790 V1129I possibly damaging Het
Abcc2 A G 19: 43,807,080 D425G probably damaging Het
Adamts15 T A 9: 30,922,026 D71V probably damaging Het
Add1 A G 5: 34,616,705 H435R possibly damaging Het
AI464131 G T 4: 41,497,568 Y687* probably null Het
Akr1c19 A G 13: 4,242,592 N204S probably benign Het
Ankub1 C A 3: 57,690,416 R44S possibly damaging Het
Ano3 T A 2: 110,666,456 N783Y probably damaging Het
Bbs9 A G 9: 22,514,063 M138V probably benign Het
Ccdc18 G A 5: 108,197,795 E936K possibly damaging Het
Cit T G 5: 115,988,159 L1604V probably benign Het
Col2a1 T A 15: 97,976,773 S1396C unknown Het
Col3a1 G C 1: 45,335,764 G653R unknown Het
Col6a1 T C 10: 76,725,029 E45G probably damaging Het
Col9a3 T A 2: 180,607,657 F271I probably damaging Het
Cyp2g1 C A 7: 26,819,153 D364E probably damaging Het
Dmbt1 T A 7: 131,106,432 V1457D possibly damaging Het
Dnah17 A T 11: 118,128,927 I98N possibly damaging Het
Dyrk1b T A 7: 28,183,176 M222K possibly damaging Het
Epha8 T C 4: 136,945,663 D270G probably benign Het
Fbxw17 T C 13: 50,425,624 L159P probably damaging Het
Fgl2 G A 5: 21,373,309 probably null Het
Fmnl1 A T 11: 103,189,959 M309L probably damaging Het
Fn1 T C 1: 71,609,587 I1479V probably benign Het
Gm11939 A T 11: 99,559,298 S57T possibly damaging Het
Gm5415 T C 1: 32,546,376 E151G probably benign Het
Gm9195 C T 14: 72,460,537 A1268T possibly damaging Het
Gnpda1 A G 18: 38,333,295 W90R possibly damaging Het
Igkv5-43 T A 6: 69,823,461 R81W probably damaging Het
Mapk3 T A 7: 126,763,765 W230R probably null Het
Mplkip A G 13: 17,695,620 S46G probably benign Het
Mrs2 T C 13: 25,004,978 T118A probably benign Het
Mst1r T A 9: 107,907,585 H147Q probably damaging Het
Muc5ac G C 7: 141,807,331 G1460R probably damaging Het
Naip1 T C 13: 100,427,403 H418R probably benign Het
Ncapg A G 5: 45,693,753 T763A probably benign Het
Nr6a1 T C 2: 38,729,498 I462V probably benign Het
Nudcd3 T C 11: 6,193,460 D70G possibly damaging Het
Nup210 A G 6: 91,014,488 S1858P probably benign Het
Olfr1080 T A 2: 86,553,279 I282F noncoding transcript Het
Olfr1110 C A 2: 87,135,950 V124L possibly damaging Het
Olfr1148 T A 2: 87,833,168 I43N probably benign Het
Olfr2 G C 7: 107,001,456 L135V probably damaging Het
Olfr775 A G 10: 129,250,921 H129R probably benign Het
Pde4dip T C 3: 97,767,532 T23A probably damaging Het
Rbm27 A G 18: 42,324,110 K694R probably damaging Het
Rnf40 T G 7: 127,596,150 D549E probably benign Het
Rpl22 A G 4: 152,327,511 K15E probably damaging Het
Rsph6a T A 7: 19,074,239 D697E unknown Het
Sec23b C T 2: 144,585,623 P590L probably benign Het
Slc17a7 T A 7: 45,174,932 M524K probably benign Het
Slc28a1 G A 7: 81,164,416 D454N probably benign Het
Slc6a13 C T 6: 121,325,028 R190* probably null Het
Slc7a9 G A 7: 35,456,133 V257I probably benign Het
Slco1a6 T A 6: 142,101,734 M377L probably damaging Het
Slit3 A G 11: 35,579,092 E307G probably damaging Het
Smchd1 A G 17: 71,390,453 M1164T probably benign Het
Stk4 T C 2: 164,088,857 I126T probably damaging Het
Syndig1 A T 2: 149,899,868 S125C probably damaging Het
Synm T C 7: 67,734,065 D1283G probably benign Het
Tmprss6 T C 15: 78,465,127 M73V probably benign Het
Tmprss9 A G 10: 80,895,048 I803V probably benign Het
Tmx4 A T 2: 134,643,902 V35E probably damaging Het
Topbp1 T G 9: 103,320,541 S440A probably benign Het
Twf1 T C 15: 94,584,395 I157V possibly damaging Het
Vmn1r205 T C 13: 22,592,245 N229S probably benign Het
Vmn1r27 T A 6: 58,215,774 I82L probably benign Het
Vmn2r112 A G 17: 22,603,613 N424S possibly damaging Het
Vmn2r68 A T 7: 85,222,214 Y620* probably null Het
Zfp51 A G 17: 21,463,867 D248G probably benign Het
Other mutations in Pex6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Pex6 APN 17 46725304 missense probably benign 0.00
IGL01601:Pex6 APN 17 46723724 missense probably damaging 1.00
IGL01710:Pex6 APN 17 46725326 unclassified probably benign
IGL02392:Pex6 APN 17 46723499 missense probably damaging 1.00
IGL02419:Pex6 APN 17 46724435 missense possibly damaging 0.69
G5030:Pex6 UTSW 17 46715456 intron probably benign
R0091:Pex6 UTSW 17 46711918 missense probably damaging 1.00
R0243:Pex6 UTSW 17 46723737 critical splice donor site probably null
R0732:Pex6 UTSW 17 46724700 missense probably damaging 1.00
R1529:Pex6 UTSW 17 46714064 missense probably benign 0.10
R1602:Pex6 UTSW 17 46712137 missense probably benign 0.09
R1638:Pex6 UTSW 17 46722632 missense probably benign
R1757:Pex6 UTSW 17 46723498 missense probably damaging 1.00
R3769:Pex6 UTSW 17 46724385 splice site probably null
R4684:Pex6 UTSW 17 46712101 missense probably benign 0.01
R4731:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4731:Pex6 UTSW 17 46724707 splice site probably null
R4732:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4732:Pex6 UTSW 17 46724707 splice site probably null
R4733:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4733:Pex6 UTSW 17 46724707 splice site probably null
R4915:Pex6 UTSW 17 46714056 missense probably damaging 0.96
R5996:Pex6 UTSW 17 46714458 splice site probably null
R6156:Pex6 UTSW 17 46720641 missense probably benign 0.02
R6227:Pex6 UTSW 17 46712108 missense probably benign 0.00
R7054:Pex6 UTSW 17 46720521 missense probably benign
R7635:Pex6 UTSW 17 46724017 missense probably damaging 1.00
R8034:Pex6 UTSW 17 46722399 missense possibly damaging 0.67
R8330:Pex6 UTSW 17 46712134 missense possibly damaging 0.55
R8348:Pex6 UTSW 17 46723113 missense probably benign
R8695:Pex6 UTSW 17 46712049 missense probably damaging 0.97
Z1088:Pex6 UTSW 17 46712222 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATGTGGGTACTGGCTGCTAC -3'
(R):5'- CTTAGAATGTCCCAATTCACCTCAG -3'

Sequencing Primer
(F):5'- CTGCTACGAGTGTAAAACCTGACTG -3'
(R):5'- ATTCACCTCAGGCTTACTCCAAGG -3'
Posted On2020-07-13