Incidental Mutation 'R8177:Smchd1'
ID 634449
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 067602-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R8177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71697448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1164 (M1164T)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably benign
Transcript: ENSMUST00000127430
AA Change: M1164T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: M1164T

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,174 (GRCm39) Y127* probably null Het
Abcb5 C T 12: 118,836,525 (GRCm39) V1129I possibly damaging Het
Abcc2 A G 19: 43,795,519 (GRCm39) D425G probably damaging Het
Adamts15 T A 9: 30,833,322 (GRCm39) D71V probably damaging Het
Add1 A G 5: 34,774,049 (GRCm39) H435R possibly damaging Het
Akr1c19 A G 13: 4,292,591 (GRCm39) N204S probably benign Het
Ankub1 C A 3: 57,597,837 (GRCm39) R44S possibly damaging Het
Ano3 T A 2: 110,496,801 (GRCm39) N783Y probably damaging Het
Bbs9 A G 9: 22,425,359 (GRCm39) M138V probably benign Het
Ccdc18 G A 5: 108,345,661 (GRCm39) E936K possibly damaging Het
Cit T G 5: 116,126,218 (GRCm39) L1604V probably benign Het
Col2a1 T A 15: 97,874,654 (GRCm39) S1396C unknown Het
Col3a1 G C 1: 45,374,924 (GRCm39) G653R unknown Het
Col6a1 T C 10: 76,560,863 (GRCm39) E45G probably damaging Het
Col9a3 T A 2: 180,249,450 (GRCm39) F271I probably damaging Het
Cyp2g1 C A 7: 26,518,578 (GRCm39) D364E probably damaging Het
Dmbt1 T A 7: 130,708,162 (GRCm39) V1457D possibly damaging Het
Dnah17 A T 11: 118,019,753 (GRCm39) I98N possibly damaging Het
Dyrk1b T A 7: 27,882,601 (GRCm39) M222K possibly damaging Het
Epha8 T C 4: 136,672,974 (GRCm39) D270G probably benign Het
Fbxw17 T C 13: 50,579,660 (GRCm39) L159P probably damaging Het
Fgl2 G A 5: 21,578,307 (GRCm39) probably null Het
Fmnl1 A T 11: 103,080,785 (GRCm39) M309L probably damaging Het
Fn1 T C 1: 71,648,746 (GRCm39) I1479V probably benign Het
Gm11939 A T 11: 99,450,124 (GRCm39) S57T possibly damaging Het
Gm9195 C T 14: 72,697,977 (GRCm39) A1268T possibly damaging Het
Gnpda1 A G 18: 38,466,348 (GRCm39) W90R possibly damaging Het
Igkv5-43 T A 6: 69,800,445 (GRCm39) R81W probably damaging Het
Mapk3 T A 7: 126,362,937 (GRCm39) W230R probably null Het
Mplkip A G 13: 17,870,205 (GRCm39) S46G probably benign Het
Mrs2 T C 13: 25,188,961 (GRCm39) T118A probably benign Het
Mst1r T A 9: 107,784,784 (GRCm39) H147Q probably damaging Het
Muc5ac G C 7: 141,361,068 (GRCm39) G1460R probably damaging Het
Myorg G T 4: 41,497,568 (GRCm39) Y687* probably null Het
Naip1 T C 13: 100,563,911 (GRCm39) H418R probably benign Het
Ncapg A G 5: 45,851,095 (GRCm39) T763A probably benign Het
Nr6a1 T C 2: 38,619,510 (GRCm39) I462V probably benign Het
Nudcd3 T C 11: 6,143,460 (GRCm39) D70G possibly damaging Het
Nup210 A G 6: 90,991,470 (GRCm39) S1858P probably benign Het
Or12e13 T A 2: 87,663,512 (GRCm39) I43N probably benign Het
Or5aq1 C A 2: 86,966,294 (GRCm39) V124L possibly damaging Het
Or6a2 G C 7: 106,600,663 (GRCm39) L135V probably damaging Het
Or6c205 A G 10: 129,086,790 (GRCm39) H129R probably benign Het
Or8k33 T A 2: 86,383,623 (GRCm39) I282F noncoding transcript Het
Pde4dip T C 3: 97,674,848 (GRCm39) T23A probably damaging Het
Pex6 A G 17: 47,024,988 (GRCm39) Q347R probably benign Het
Rbm27 A G 18: 42,457,175 (GRCm39) K694R probably damaging Het
Rnf40 T G 7: 127,195,322 (GRCm39) D549E probably benign Het
Rpl22 A G 4: 152,411,968 (GRCm39) K15E probably damaging Het
Rsph6a T A 7: 18,808,164 (GRCm39) D697E unknown Het
Sec23b C T 2: 144,427,543 (GRCm39) P590L probably benign Het
Semp2l1 T C 1: 32,585,457 (GRCm39) E151G probably benign Het
Slc17a7 T A 7: 44,824,356 (GRCm39) M524K probably benign Het
Slc28a1 G A 7: 80,814,164 (GRCm39) D454N probably benign Het
Slc6a13 C T 6: 121,301,987 (GRCm39) R190* probably null Het
Slc7a9 G A 7: 35,155,558 (GRCm39) V257I probably benign Het
Slco1a6 T A 6: 142,047,460 (GRCm39) M377L probably damaging Het
Slit3 A G 11: 35,469,919 (GRCm39) E307G probably damaging Het
Stk4 T C 2: 163,930,777 (GRCm39) I126T probably damaging Het
Syndig1 A T 2: 149,741,788 (GRCm39) S125C probably damaging Het
Synm T C 7: 67,383,813 (GRCm39) D1283G probably benign Het
Tmprss6 T C 15: 78,349,327 (GRCm39) M73V probably benign Het
Tmprss9 A G 10: 80,730,882 (GRCm39) I803V probably benign Het
Tmx4 A T 2: 134,485,822 (GRCm39) V35E probably damaging Het
Topbp1 T G 9: 103,197,740 (GRCm39) S440A probably benign Het
Twf1 T C 15: 94,482,276 (GRCm39) I157V possibly damaging Het
Vmn1r205 T C 13: 22,776,415 (GRCm39) N229S probably benign Het
Vmn1r27 T A 6: 58,192,759 (GRCm39) I82L probably benign Het
Vmn2r112 A G 17: 22,822,594 (GRCm39) N424S possibly damaging Het
Vmn2r68 A T 7: 84,871,422 (GRCm39) Y620* probably null Het
Zfp51 A G 17: 21,684,129 (GRCm39) D248G probably benign Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CGCCTAAAGGAAACGCTTAATG -3'
(R):5'- TCTTGCATCAGTAGCAATGAGAAG -3'

Sequencing Primer
(F):5'- CCTAAAGGAAACGCTTAATGGTATG -3'
(R):5'- AGTGAAAGATTTGGAGGGCTCTG -3'
Posted On 2020-07-13