Incidental Mutation 'R8178:Rbm39'
ID634463
Institutional Source Beutler Lab
Gene Symbol Rbm39
Ensembl Gene ENSMUSG00000027620
Gene NameRNA binding motif protein 39
SynonymsB330012G18Rik, Caper alpha, 1500012C14Rik, caper, Rnpc2, 2310040E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location156147239-156180238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156154275 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 397 (I397V)
Ref Sequence ENSEMBL: ENSMUSP00000105216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029149] [ENSMUST00000109587] [ENSMUST00000142071] [ENSMUST00000146297] [ENSMUST00000153514] [ENSMUST00000155837]
PDB Structure
NMR structure of the RNA binding motif 39 (RBM39) from Mus musculus [SOLUTION NMR]
Crystal structure of a RNA binding motif protein 39 (RBM39) from Mus musculuS at 0.95 A resolution [X-RAY DIFFRACTION]
Room temperature crystal structure of a RNA binding motif protein 39 (Rbm39) from Mus musculus at 1.11 A resolution [X-RAY DIFFRACTION]
Crystal structure of a RNA-binding protein 39 (RBM39) in complex with fragment of splicing factor (U2AF) from Mus musculus at 2.20 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000029149
SMART Domains Protein: ENSMUSP00000029149
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109587
AA Change: I397V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105216
Gene: ENSMUSG00000027620
AA Change: I397V

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 403 422 N/A INTRINSIC
RRM 425 504 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142071
SMART Domains Protein: ENSMUSP00000116820
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
Pfam:RBM39linker 339 404 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146297
SMART Domains Protein: ENSMUSP00000119298
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148794
AA Change: I236V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117462
Gene: ENSMUSG00000027620
AA Change: I236V

DomainStartEndE-ValueType
RRM 16 88 2.5e-15 SMART
RRM 113 164 2.45e-9 SMART
Pfam:RBM39linker 181 282 6.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153514
Predicted Effect probably benign
Transcript: ENSMUST00000155837
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U2AF65 family of proteins. The encoded protein is found in the nucleus, where it co-localizes with core spliceosomal proteins. It has been shown to play a role in both steroid hormone receptor-mediated transcription and alternative splicing, and it is also a transcriptional coregulator of the viral oncoprotein v-Rel. Multiple transcript variants have been observed for this gene. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous disruption of this locus results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Rbm39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Rbm39 APN 2 156162871 missense probably damaging 1.00
IGL01473:Rbm39 APN 2 156172979 nonsense probably null
R0040:Rbm39 UTSW 2 156148179 missense possibly damaging 0.90
R1564:Rbm39 UTSW 2 156154257 missense probably benign 0.01
R2888:Rbm39 UTSW 2 156167583 missense probably benign 0.01
R4872:Rbm39 UTSW 2 156177346 missense possibly damaging 0.94
R5124:Rbm39 UTSW 2 156159162 missense probably damaging 0.99
R5125:Rbm39 UTSW 2 156162865 missense probably damaging 0.99
R5843:Rbm39 UTSW 2 156162873 missense possibly damaging 0.84
R6714:Rbm39 UTSW 2 156161618 missense possibly damaging 0.82
R6820:Rbm39 UTSW 2 156179226 start codon destroyed probably null 0.66
R6970:Rbm39 UTSW 2 156167584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAAGGACAGCATGTTAAGC -3'
(R):5'- CCCAAAGCCTTGTAAATGAGG -3'

Sequencing Primer
(F):5'- CAAGGACAGCATGTTAAGCTATTTC -3'
(R):5'- CCCAAAGCCTTGTAAATGAGGAATGG -3'
Posted On2020-07-13