Incidental Mutation 'R8178:Prdm2'
ID634467
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143132448 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1424 (I1424T)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably benign
Transcript: ENSMUST00000105778
AA Change: I1424T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: I1424T

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTTCTTTTGGAAGGAGAAAGGG -3'
(R):5'- CATCTTGGCGTGTGCATCTG -3'

Sequencing Primer
(F):5'- GTCACAGTAAGGGCAGAT -3'
(R):5'- AGTGCCGCTGAGACAGAC -3'
Posted On2020-07-13