Incidental Mutation 'R8178:Dpp6'
ID634469
Institutional Source Beutler Lab
Gene Symbol Dpp6
Ensembl Gene ENSMUSG00000061576
Gene Namedipeptidylpeptidase 6
SynonymsRw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location26817203-27727505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27598817 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 254 (N254Y)
Ref Sequence ENSEMBL: ENSMUSP00000113441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect probably damaging
Transcript: ENSMUST00000071500
AA Change: N199Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: N199Y

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101471
AA Change: N198Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: N198Y

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120555
AA Change: N196Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: N196Y

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122171
AA Change: N254Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: N254Y

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Dpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Dpp6 APN 5 27723443 missense probably damaging 1.00
IGL01137:Dpp6 APN 5 27714488 missense probably damaging 1.00
IGL01386:Dpp6 APN 5 27664762 critical splice donor site probably null
IGL01409:Dpp6 APN 5 27557601 missense probably damaging 1.00
IGL01721:Dpp6 APN 5 27631520 missense probably damaging 1.00
IGL02149:Dpp6 APN 5 27538024 missense probably benign 0.00
IGL02174:Dpp6 APN 5 27721087 nonsense probably null
IGL02176:Dpp6 APN 5 27723577 missense probably damaging 0.98
IGL02326:Dpp6 APN 5 27664757 missense probably damaging 1.00
IGL02336:Dpp6 APN 5 27469411 missense probably benign 0.04
IGL02339:Dpp6 APN 5 27652230 missense probably damaging 0.97
IGL02402:Dpp6 APN 5 27634543 missense probably damaging 1.00
IGL02884:Dpp6 APN 5 27634556 missense possibly damaging 0.88
IGL02885:Dpp6 APN 5 27718473 missense probably damaging 1.00
IGL02938:Dpp6 APN 5 27723367 splice site probably benign
IGL03083:Dpp6 APN 5 27709550 critical splice donor site probably null
I0000:Dpp6 UTSW 5 27398922 missense probably benign 0.02
IGL03052:Dpp6 UTSW 5 27709508 missense probably benign 0.03
PIT4431001:Dpp6 UTSW 5 27631498 missense probably benign 0.03
R0060:Dpp6 UTSW 5 27598819 missense probably damaging 1.00
R0360:Dpp6 UTSW 5 27652269 missense probably damaging 1.00
R0486:Dpp6 UTSW 5 27661642 missense probably benign 0.39
R0501:Dpp6 UTSW 5 27725606 missense probably damaging 1.00
R1028:Dpp6 UTSW 5 27666427 missense probably benign 0.01
R1164:Dpp6 UTSW 5 27721105 missense probably benign 0.02
R1177:Dpp6 UTSW 5 27663473 missense possibly damaging 0.94
R1993:Dpp6 UTSW 5 27399006 missense probably benign 0.00
R2024:Dpp6 UTSW 5 27709459 missense possibly damaging 0.67
R2100:Dpp6 UTSW 5 27664744 missense probably damaging 0.96
R2329:Dpp6 UTSW 5 27451288 splice site probably null
R3619:Dpp6 UTSW 5 27721120 missense possibly damaging 0.74
R3871:Dpp6 UTSW 5 27469465 missense probably benign 0.03
R3872:Dpp6 UTSW 5 27721058 missense probably damaging 1.00
R4114:Dpp6 UTSW 5 27469487 critical splice donor site probably null
R4403:Dpp6 UTSW 5 27718462 missense probably damaging 1.00
R4599:Dpp6 UTSW 5 27634548 missense probably damaging 1.00
R4736:Dpp6 UTSW 5 27712659 missense probably damaging 1.00
R4929:Dpp6 UTSW 5 27049787 missense probably benign 0.25
R4967:Dpp6 UTSW 5 27666511 missense probably damaging 1.00
R5162:Dpp6 UTSW 5 27399015 unclassified probably benign
R5270:Dpp6 UTSW 5 27634534 missense probably damaging 0.98
R5334:Dpp6 UTSW 5 27709540 missense probably benign 0.30
R5437:Dpp6 UTSW 5 27663501 nonsense probably null
R5663:Dpp6 UTSW 5 27049622 missense possibly damaging 0.84
R6023:Dpp6 UTSW 5 27723547 missense probably damaging 0.96
R6244:Dpp6 UTSW 5 27049628 missense probably damaging 0.99
R6312:Dpp6 UTSW 5 27725671 missense possibly damaging 0.84
R6442:Dpp6 UTSW 5 27718509 critical splice donor site probably null
R6942:Dpp6 UTSW 5 27469459 missense possibly damaging 0.79
R6956:Dpp6 UTSW 5 27598821 missense probably damaging 1.00
R7210:Dpp6 UTSW 5 27598803 missense probably damaging 0.99
R7342:Dpp6 UTSW 5 27714554 missense probably benign
R7702:Dpp6 UTSW 5 27652276 missense probably benign 0.00
R7727:Dpp6 UTSW 5 27451244 missense probably benign 0.30
R7899:Dpp6 UTSW 5 27721079 missense probably benign 0.03
R7966:Dpp6 UTSW 5 27723372 missense probably benign 0.06
R8015:Dpp6 UTSW 5 26817810 start gained probably benign
R8084:Dpp6 UTSW 5 27631399 missense probably benign 0.32
R8384:Dpp6 UTSW 5 27718474 missense probably benign 0.18
Z1176:Dpp6 UTSW 5 27398998 missense probably damaging 1.00
Z1177:Dpp6 UTSW 5 27712642 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGCAGGGGAATCAACCAC -3'
(R):5'- ATCCATTAGTGCTCACCTGGATC -3'

Sequencing Primer
(F):5'- GTTGCAGGGGAATCAACCACTAATC -3'
(R):5'- GGATCTCTATCACTCTCAAGAAATCC -3'
Posted On2020-07-13