Incidental Mutation 'R8178:Cit'
ID634470
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115969072 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1088 (R1088W)
Ref Sequence ENSEMBL: ENSMUSP00000062049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
Predicted Effect probably damaging
Transcript: ENSMUST00000051704
AA Change: R1088W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: R1088W

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102560
AA Change: R1088W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: R1088W

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112008
AA Change: R1046W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: R1046W

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123736
Predicted Effect probably damaging
Transcript: ENSMUST00000141101
AA Change: R1046W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: R1046W

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0320:Cit UTSW 5 115979445 missense possibly damaging 0.87
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 splice site probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4816:Cit UTSW 5 115908691 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4899:Cit UTSW 5 115863028 missense possibly damaging 0.60
R4928:Cit UTSW 5 115985797 missense probably benign 0.00
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5154:Cit UTSW 5 115988405 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5935:Cit UTSW 5 115925539 intron probably benign
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6362:Cit UTSW 5 115886676 missense probably benign 0.01
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
R7359:Cit UTSW 5 115926574 missense probably damaging 1.00
R7597:Cit UTSW 5 115886681 nonsense probably null
R7729:Cit UTSW 5 115984822 missense possibly damaging 0.87
R7763:Cit UTSW 5 115987001 missense probably benign 0.01
R7786:Cit UTSW 5 115863018 missense probably benign 0.00
R7799:Cit UTSW 5 115862968 missense probably benign 0.00
R8060:Cit UTSW 5 115908727 missense probably benign 0.00
R8068:Cit UTSW 5 115952466 missense probably damaging 1.00
R8068:Cit UTSW 5 115982235 missense probably benign 0.03
R8122:Cit UTSW 5 115969010 missense probably damaging 1.00
R8177:Cit UTSW 5 115988159 missense probably benign 0.18
R8265:Cit UTSW 5 115988177 missense probably damaging 1.00
R8397:Cit UTSW 5 115886797 missense probably benign
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Z1176:Cit UTSW 5 115986603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACCAAAGTAACCTCCAGG -3'
(R):5'- TCTGCACAGAATAAAAGGACGC -3'

Sequencing Primer
(F):5'- AGGAATCCCCGTTTGCTACAAGG -3'
(R):5'- CTTGTCAGATCTACAGCCAGGAG -3'
Posted On2020-07-13