Mutagenetix > Incidental Mutation

Incidental Mutation 'R8178:Arhgef5'

634474

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

067603-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8178 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43275185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 957 (S957P)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably benign
Transcript: ENSMUST00000031750
AA Change: S957P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: S957P

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 99.0%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	A	G	17: 79,628,270	I276V		Het
Acsm5	C	A	7: 119,542,395	H538N	probably damaging	Het
Adamts17	A	G	7: 66,849,716	I4V	possibly damaging	Het
Adgrg3	T	C	8: 95,035,047	V146A	probably damaging	Het
Ankrd52	T	A	10: 128,389,301	L877Q	probably damaging	Het
Aox3	A	T	1: 58,150,322	D394V	possibly damaging	Het
Arhgap45	G	A	10: 80,027,872	A819T	probably damaging	Het
Arhgef4	A	G	1: 34,722,902	E413G	unknown	Het
Arsk	G	T	13: 76,091,742	T114K	probably damaging	Het
Bpifb2	T	C	2: 153,891,956	V406A	probably damaging	Het
Cbr3	C	A	16: 93,683,505	Q61K	probably benign	Het
Ccdc73	C	T	2: 104,991,212	S502L	probably benign	Het
Cdhr3	A	T	12: 33,048,932		probably null	Het
Cep170b	T	A	12: 112,739,285	M1159K	possibly damaging	Het
Cep295	A	T	9: 15,333,540	S1159T		Het
Cit	C	T	5: 115,969,072	R1088W	probably damaging	Het
Col16a1	A	T	4: 130,053,477	H205L	unknown	Het
Cpt1c	T	G	7: 44,959,653	H748P	probably damaging	Het
Dcaf8	A	T	1: 172,186,319	D359V	probably benign	Het
Dcstamp	A	G	15: 39,755,026	Y277C	probably damaging	Het
Dnah10	A	G	5: 124,755,726	K898R	probably benign	Het
Dnah6	T	A	6: 73,060,225	T3345S	probably benign	Het
Dpp6	A	T	5: 27,598,817	N254Y	probably damaging	Het
F2	A	T	2: 91,630,273		probably null	Het
Fam216b	G	C	14: 78,085,064	H67D	possibly damaging	Het
Fbxl17	A	C	17: 63,487,972		probably null	Het
Gas2	T	A	7: 51,897,278	M59K	probably damaging	Het
Glud1	G	A	14: 34,343,707	G554D	probably damaging	Het
Gm15448	T	C	7: 3,821,261	K631R	unknown	Het
Gm5483	T	G	16: 36,186,402	Y35*	probably null	Het
Gys2	C	T	6: 142,456,412	G234R	probably damaging	Het
Ifngr1	A	G	10: 19,609,493	I413M	probably benign	Het
Inpp5a	C	T	7: 139,538,237	R236C	probably damaging	Het
Kcnip3	A	G	2: 127,482,014	S32P	probably benign	Het
Lingo3	T	A	10: 80,834,630	T489S	possibly damaging	Het
Lrpprc	A	G	17: 84,772,147	L227P	probably damaging	Het
Morn1	A	G	4: 155,128,703	Q356R	probably benign	Het
Naxd	A	C	8: 11,511,987	K275Q	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nck1	A	T	9: 100,497,737	W154R	probably damaging	Het
Olfr1109	C	T	2: 87,092,876	V174M	possibly damaging	Het
Olfr51	T	A	11: 51,007,610	C213S	probably damaging	Het
Olfr869	T	C	9: 20,137,275	V53A	possibly damaging	Het
Olfr975	G	A	9: 39,950,412	R120C	probably benign	Het
Pdxk	C	T	10: 78,453,504	V38M	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pes1	T	C	11: 3,977,718	S482P	probably benign	Het
Pglyrp1	T	A	7: 18,884,732	F3I	unknown	Het
Plce1	T	A	19: 38,772,979	F2092I	possibly damaging	Het
Pms1	A	G	1: 53,207,346	S345P	probably benign	Het
Pom121l12	C	A	11: 14,600,011	P239H	probably damaging	Het
Prdm2	A	G	4: 143,132,448	I1424T	probably benign	Het
Prmt6	A	G	3: 110,250,824	Y50H	probably damaging	Het
Rbm39	T	C	2: 156,154,275	I397V	probably benign	Het
Rnf157	A	G	11: 116,347,481	V519A	possibly damaging	Het
Sec23a	T	C	12: 59,007,194	E6G	possibly damaging	Het
Shank1	T	C	7: 44,313,324		probably null	Het
Slfn3	A	G	11: 83,214,679	I378V	probably benign	Het
Smn1	T	A	13: 100,130,795		probably null	Het
Snd1	T	C	6: 28,874,976	F632S	possibly damaging	Het
Sun5	T	C	2: 153,856,211		probably null	Het
Tial1	T	C	7: 128,444,890	R209G	probably benign	Het
Trhde	T	C	10: 114,408,693	I963V	possibly damaging	Het
Tssc4	G	T	7: 143,070,195	R80L	possibly damaging	Het
Ttn	A	T	2: 76,812,508	N13261K	probably damaging	Het
Ugdh	A	T	5: 65,423,662		probably null	Het
Vmn1r218	A	T	13: 23,137,302	E273V	probably benign	Het
Vmn2r92	T	A	17: 18,166,726	F109Y	possibly damaging	Het
Zcchc7	A	G	4: 44,931,398	S196G	probably benign	Het
Zfp788	T	A	7: 41,648,911	C324S	probably damaging	Het
Zfp976	T	C	7: 42,613,535	T294A	probably benign	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTTTGCCTCTCACCAGTAGG -3'
(R):5'- CAGGCAAAATTGAAGGTCTACG -3'

Sequencing Primer
(F):5'- AGGTGTAATAATGAAGTGTCCCCTG -3'
(R):5'- GGTCTACGAAGGCCTTGC -3'

Posted On

2020-07-13